Agilent Technologies 212205, 212206, 212207, 212208 Instruction Manual
pBluescript II Phagemid Vectors
Instruction Manual
Catalog #212205, #212206, #212207 and #212208
Revision B
Research Use Only. Not for Use in Diagnostic Procedures.
212205-12
LIMITED PRODUCT WARRANTY
This warranty limits our liability to replacement of this product. No other warranties of any kind, express
or implied, including without limitation, implied warranties of merchantability or fitness for a particular
purpose, are provided by Agilent. Agilent shall have no liability for any direct, indirect, consequential, or
incidental damages arising out of the use, the results of use, or the inability to use this product.
ORDERING INFORMATION AND TECHNICAL SERVICES
Email
techservices@agilent.com
World Wide Web
www.genomics.agilent.com
Telephone
Location Telephone
United States and Canada 800 227 9770
Austria 01 25125 6800
Benelux 02 404 92 22
Denmark 45 70 13 00 30
Finland 010 802 220
France 0810 446 446
Germany 0800 603 1000
Italy 800 012575
Netherlands 020 547 2600
Spain 901 11 68 90
Sweden 08 506 4 8960
Switzerland 0848 8035 60
UK/Ireland 0845 712 5292
All Other Countries Please visit www.genomics.agilent.com and click Contact Us
pBluescript II Phagemid Vectors
CONTENTS
Materials Provided .............................................................................................................................. 1
Storage Conditions .............................................................................................................................. 1
Introduction ......................................................................................................................................... 2
pBluescript II SK (+/–) Phagemids ....................................................................................... 3
pBluescript II KS (+/–) Phagemids ....................................................................................... 4
Ligation into pBluescript II Phagemids ............................................................................................ 5
Transformation with pBluescript II Phagemids .............................................................................. 6
Suggested Host Strain and Genotype .................................................................................... 6
Streaking Cells from a –80°C Bacterial Glycerol Stock ....................................................... 7
Preparation of a –80°C Bacterial Glycerol Stock .................................................................. 7
Blue-White Color Selection .................................................................................................. 7
Background White Colonies .................................................................................................. 8
Screening Colonies .............................................................................................................................. 8
Fixing Replica Sets of Colonies to Nitrocellulose Filters ..................................................... 9
Prehybridization .................................................................................................................. 10
Hybridization ....................................................................................................................... 11
Hybridization Solution ........................................................................................................ 11
Washes ................................................................................................................................. 12
Exposure to Film ................................................................................................................. 13
T3 and T7 RNA Transcription ......................................................................................................... 13
Handling RNA ..................................................................................................................... 13
Nonspecific Initiation with T7 and T3 RNA Polymerases .................................................. 14
Nonradioactive Transcripts ................................................................................................. 15
DNase Treatment after Transcription .................................................................................. 15
High-Specific-Activity RNA Probes ................................................................................... 15
Transcription Reaction ........................................................................................................ 16
Hybridization Conditions for RNA Probes in Southern Blots ...................................................... 17
Prehybridization .................................................................................................................. 17
Hybridization ....................................................................................................................... 17
Washes ................................................................................................................................. 17
Hybridization Conditions for RNA Probes in Northern Blots ...................................................... 17
Prehybridization .................................................................................................................. 17
Hybridization ....................................................................................................................... 17
Washes ................................................................................................................................. 17
Recovery of Single-Stranded DNA from Cells Containing pBluescript II Phagemids ............... 18
Single-Stranded Rescue Protocol ........................................................................................ 19
Site-Directed Mutagenesis ................................................................................................................ 20
Plasmid Boiling Miniprep Protocol ................................................................................................. 21
Troubleshooting ................................................................................................................................ 22
Preparation of Media and Reagents ................................................................................................ 22
References .......................................................................................................................................... 23
Endnotes ............................................................................................................................................. 23
MSDS Information ............................................................................................................................ 23
pBluescript II Phagemid Vectors
ATERIALS PROVIDED
M
Material Provided
pBluescript II SK(+) phagemid, 1 μg/μl 20 μg — — —
pBluescript II SK(–) phagemid, 1 μg/μl — 20 μg — —
pBluescript II KS(+) phagemid, 1 μg/μl — — 20 μg —
pBluescript II KS(–) phagemid, 1 μg/μl — — — 20 μg
XL1-Blue MRF´ host strain, glycerol stock, Catalog #200301 1 tube 1 tube 1 tube 1 tube
#212205 #212206 #212207 #212208
Catalog Number
STORAGE CONDITIONS
Phagemids: –20°C
Bacterial Strains: –80°C
Revision B © Agilent Technologies, Inc. 2010.
pBluescript II Phagemid Vectors 1
INTRODUCTION
The pBluescript II phagemids (plasmids with a phage origin) are cloning
vectors designed to simplify commonly used cloning and sequencing
procedures, including the construction of nested deletions for DNA
sequencing, generation of RNA transcripts in vitro and site-specific
mutagenesis and gene mapping. The pBluescript II phagemids have an
extensive polylinker with 21 unique restriction enzyme recognition sites.
Flanking the polylinker are T7 and T3 RNA polymerase promoters that can
be used to synthesize RNA in vitro.
1, 2
The choice of promoter used to
initiate transcription determines which strand of the insert cloned into the
polylinker will be transcribed.
Circular maps and lists of features for the pBluescript II phagemids are
shown in figures 1 and 2. The polylinker and T7 and T3 RNA polymerase
promoter sequences are present in the N-terminal portion of a lacZ gene
fragment. A total of 131 amino acids of β-galactosidase coding sequence is
present in the pBluescript II phagemid, but the coding sequence is
interrupted by the large polylinker. (There are 36 amino acids from the
initiator Met sequence to the EcoR I site.) pBluescript II phagemids having
no inserts in the polylinker will produce blue colonies in the appropriate
strains of bacteria (i.e., strains containing lacZΔM15 on an F´ episome, such
as XL1-Blue MRF´, among others). pBluescript II phagemids that have
inserts will produce white colonies using the same strain, because the inserts
disrupt the coding region of the lacZ gene fragment.
pBluescript II (+) and (–) are available with two polylinker orientations
designated as either KS or SK using the following convention: (1) in the KS
orientation, the Kpn I restriction site is nearest the lacZ promoter and the
Sac I restriction site is farthest from the lacZ promoter; and (2) in the SK
orientation, the Sac I site is the closest restriction site to the lacZ promoter
and the Kpn I site is the farthest.
Flanking the T3 and T7 promoters are BssH II sites. This rare six-base cutter
will allow the insert plus the T phage RNA promoters to be excised and
used for gene mapping.
pBluescript II phagemids can be rescued as single-stranded (ss) DNA.
pBluescript II phagemids contain a 454-bp filamentous f1 phage intergenic
region (M13 related), which includes the 307-bp origin of replication. The
(+) and (–) orientations of the f1 intergenic region allow the rescue of sense
or antisense ssDNA by a helper phage. This ssDNA can be used for
dideoxynucleotide sequencing (Sanger method) or site-specific mutagenesis.
Note We have observed that using excess amounts of EcoR I to digest
pBluescript II results in EcoR I prime activity. This appears as
cleavage at a non-EcoR I site at the 3´ end of the f1 intergenic
region, causing confusion when interpreting results from an
agarose gel. If a restriction pattern appears incorrect, check
whether reducing the units of EcoR I restores a normal restriction
pattern.
2 pBluescript II Phagemid Vectors
pBluescript II SK (+/–) Phagemids
n
f1 (+) ori
ampicillin
pBluescript II SK (+/-)
3.0 kb
pUC ori
pBluescript II SK (+/–) Multiple Cloning Site Regio
(sequence shown 598–826)
BssH II
TTGTAAAACGACGGCCAGTGAGCGCGCGTAATACGACTCACTATAGGGCGAATTGGGTACCGGGCCCCCCCTCGAGGTCGAC...
M13 –20 primer binding site
...GGTATCGATAAGCTTGATATCGAATTCCTGCAGCCCGGGGGATCCACTAGTTCTAGAGCGGCCGCCACCGCGGTGGAGCTC...
Bsp106 I
Cla I BamH I
EcoR IEcoR V
T7 Promoter
T7 primer binding site
Spe ISma I Xba IPst IHind III
SK primer binding site...KS primer binding site
f1 (-) ori
Kpn I
lacZ'
Kpn I
MCS
Sac I
P lac
Apa I
EcoO109 I
Dra II
Not I
Eag I
Xho I
KS primer binding site...
Sac II
BstX I
Hinc II
Acc I
Sal I
Sac I
T3 Promoter
...CAGCTTTTGTTCCCTTTAGTGAGGGTTAATTGCGCGCTTGGCGTAATCATGGTCATAGCTGTTTCC
T3 primer binding site
BssH II
βα
-gal -fragment
M13 Reverse primer binding site
Feature Nucleotide Position
f1 (+) origin of ss-DNA replication [pBluescript SK (+) only] 135–441
f1 (–) origin of ss-DNA replication [pBluescript SK (–) only] 21–327
β-galactosidase α-fragment coding sequence (lacZ’) 460–816
multiple cloning site 653–760
T7 promoter transcription initiation site 643
T3 promoter transcription initiation site 774
lac promoter 817–938
pUC origin of replication 1158–1825
ampicillin resistance (bla) ORF 1976–2833
FIGURE 1 The pBluescript II SK (+/–) phagemid vectors. The complete sequence and list of restriction sites are available at
www.genomics.agilent.com.
Genbank
®
#X52328 [SK(+)] and #X52330 [SK(–)].
pBluescript II Phagemid Vectors 3
pBluescript II KS (+/–) Phagemids
f1 (+) ori
ampicillin
pBluescript II KS (+/-)
3.0 kb
pUC ori
pBluescript II KS (+/–) Multiple Cloning Site Region
(sequence shown 598–826)
BssH II
TTGTAAAACGACGGCCAGTGAGCGCGCGTAAT ACGACTCACTA TAGGGCGAAT ...
M13 –20 primer binding site T7 primer binding site
Spe I Sma I
...ACTAGTGGATCCCCCGGGCTGCAGGAATT CGATATCAAGC TTATCGATACCG TCGACCTCGAG GGGGGGCCCGG TACC...
...SK primer binding site
Pst I
EcoR I EcoR V
T7 Promoter
Hind III
Bsp106 I
Cla IBamH I
f1 (-) ori
lacZ'
Sac I
MCS
Kpn I
P lac
Sac I
TGGAGCTCCACCGC GGTGGCGGCCGCTCTAGA
Hinc II
Acc I
Sal I
KS primer binding site
BstX I
Sac II
Not I
Eag I
SK primer binding site...
Apa I
EcoO109 I
Dra II
Kpn IXho I
Xba I
T3 Promoter
...CAGCTTTTGTTCCCTTTAGTGAGGGTTAA TTGCGCGCTTG GCGTAATCATGG TCATAGCTGTT TCC
T3 primer binding site
BssH II
βα
-gal -fragment
M13 Reverse primer binding site
Feature Nucleotide Position
f1 (+) origin of ss-DNA replication [pBluescript KS (+) only] 135–441
f1 (–) origin of ss-DNA replication [pBluescript KS (–) only] 21–327
β-galactosidase α-fragment coding sequence (lacZ’) 460–816
multiple cloning site 653–760
T7 promoter transcription initiation site 643
T3 promoter transcription initiation site 774
lac promoter 817–938
pUC origin of replication 1158–1825
ampicillin resistance (bla) ORF 1976–2833
FIGURE 2 The pBluescript II KS (+/–) phagemid vectors. The complete sequence and list of restriction sites are available at
www.genomics.agilent.com. Genbank
®
#X52327 [KS(+)] and #X52329 [KS(–)].
4 pBluescript II Phagemid Vectors
LIGATION INTO PBLUESCRIPT II PHAGEMIDS
Dephosphorylate the digested pBluescript II phagemid with calf intestinal
alkaline phosphatase (CIAP) prior to ligation with the insert DNA. If more
than one restriction enzyme is used, the background can be reduced further
by electrophoresing the digested vector DNA on an agarose gel and
recovering the desired vector band through electroelution, leaving behind
the small fragment that appears between the two restriction enzyme sites.
After gel purification and ethanol precipitation of the DNA, resuspend in a
volume of TE buffer [5 mM Tris (pH 7.5), 0.1 mM EDTA] that will allow
the concentration of the vector DNA to be the same as the concentration of
the insert DNA (~0.1 μg/μl).
For ligation, the ideal ratio of insert to vector DNA is variable; however, a
reasonable starting point is 2:1 (insert:vector), measured in available
picomole ends. This is calculated as:
picomole ends/micrograms of DNA = (2 × 106) ÷ (number of base pairs × 660)
We suggest the following protocol, which includes three controls:
Component 1 2 3 4 5
Prepared vector (0.1 μg/μl) 1 μl 1 μl 1 μl 1 μl 0 μl
Prepared insert (0.1 μg/μl) X μl X μl 0 μl 0 μl 1 μl
10 mM rATP (pH 7.0) 1 μl 1 μl 1 μl 1 μl 1 μl
10× Ligase buffer 1 μl 1 μl 1 μl 1 μl 1 μl
T4 DNA ligase (4 U/μl) 0.5 μl 0.5 μl 0.5 μl 0 μl 0.5 μl
ddH2O (to 10 μl) X μl X μl X μl X μl X μl
1. Ligate for 2 hours at room temperature (22°C) or overnight at 4°C.
When ligating blunt ends, incubate the ligation overnight at 12–14°C.
2. Transform 1–2 μl of the ligation mix into the appropriate competent
bacteria. (See Transformation with pBluescript II Phagemids.) Plate on
selective media.
3. Interpretation of test results:
Reactions 1 and 2 vary the insert:vector ratio.
Control 3 tests for the effectiveness of the CIAP treatment.
Control 4 indicates if the vector was cleaved completely or if
residual uncut vector remains.
Control 5 verifies that the insert alone is not contaminated with
any vector DNA.
pBluescript II Phagemid Vectors 5
Loading...