Sutter Instrument ZAP-CMV RI Instruction Manual
Lambda ZAP-CMV RI Predigested
Vector Kit
INSTRUCTION MANUAL
Catalog #239221 (Lambda ZAP-CMV RI Predigested Vector Kit)
Revision A
For In Vitro Use Only
239221-12
LIMITED PRODUCT WARRANTY
This warranty limits our liability to replacement of this product. No other warranties of any kind,
express or implied, including without limitation, implied warranties of merchantability or fitness for
a particular purpose, are provided by Agilent. Agilent shall have no liability for any direct, indirect,
consequential, or incidental damages arising out of the use, the results of use, or the inability to use
this product.
ORDERING INFORMATION AND TECHNICAL SERVICES
United States and Canada
Agilent Technologies
Stratagene Products Division
11011 North Torrey Pines Road
La Jolla, CA 92037
Telephone (858) 373-6300
Order Toll Free (800) 424-5444
Technical Services
Internet
World Wide Web
techservices@agilent.com
Europe
Location Telephone Fax Technical Services
Austria 0800 292 499 0800 292 496 0800 292 498
(800) 894-1304
www.stratagene.com
00800 7000 7000 00800 7001 7001 00800 7400 7400 Belgium
0800 15775 0800 15740 0800 15720
00800 7000 7000 00800 7001 7001 00800 7400 7400 France
0800 919 288 0800 919 287 0800 919 289
00800 7000 7000 00800 7001 7001 00800 7400 7400 Germany
0800 182 8232 0800 182 8231 0800 182 8234
00800 7000 7000 00800 7001 7001 00800 7400 7400 Netherlands
0800 023 0446 +31 (0)20 312 5700 0800 023 0448
00800 7000 7000 00800 7001 7001 00800 7400 7400 Switzerland
0800 563 080 0800 563 082 0800 563 081
00800 7000 7000 00800 7001 7001 00800 7400 7400 United Kingdom
0800 917 3282 0800 917 3283 0800 917 3281
All Other Countries
Please contact your local distributor. A complete list of distributors is available at www.stratagene.com.
Lambda ZAP-CMV RI Predigested Vector Kit
CONTENTS
Materials Provided.............................................................................................................................. 1
Storage Conditions.............................................................................................................................. 1
Additional Materials Required .......................................................................................................... 1
Notice to Purchaser ............................................................................................................................. 1
Introduction......................................................................................................................................... 2
Overview of the Lambda ZAP-CMV RI Vector System....................................................... 2
Lambda ZAP-CMV Vector Map........................................................................................... 2
pCMV-Script EX Vector Map............................................................................................... 3
Bacterial Host Strains ......................................................................................................................... 4
Host Strain Genotypes...........................................................................................................4
XL1-Blue MRF´ Bacterial Strain Description....................................................................... 4
Recommended Media............................................................................................................ 5
Establishing an Agar Plate Bacterial Stock ........................................................................... 5
Preparing a –80°C Bacterial Glycerol Stock ......................................................................... 5
Growth of Cells for Plating Phage......................................................................................... 6
Helper Phage ....................................................................................................................................... 6
Storing the Helper Phage....................................................................................................... 6
Titering the Helper Phage...................................................................................................... 6
Amplifying the Helper Phage................................................................................................ 7
Ligating the Insert............................................................................................................................... 8
Packaging Reaction............................................................................................................................. 9
General Information ..............................................................................................................9
Packaging Instructions......................................................................................................... 10
Titering the Packaging Reaction ......................................................................................... 10
Amplifying the Library..................................................................................................................... 12
Performing Plaque Lifts ................................................................................................................... 13
Hybridizing and Screening............................................................................................................... 14
In Vivo Excision of the pCMV-Script EX Phagemid Vector from the Lambda ZAP-CMV RI
Vector ......................................................................................................................................... 15
In Vivo Excision Protocols Using ExAssist Helper Phage with XLOLR Strain.......................... 16
Single-Clone Excision Protocol .......................................................................................... 16
Mass Excision Protocol ....................................................................................................... 18
Eukaryotic Screening with the Lambda ZAP-CMV RI Library.................................................. 20
Panning Assay ..................................................................................................................... 20
Functional Assay ................................................................................................................. 20
Eukaryotic Expression...................................................................................................................... 21
Appendix: Recovery of Single-Stranded DNA from Cells Containing the pCMV-Script EX
Phagemid Vector ....................................................................................................................... 22
Single-Stranded Rescue Protocol ........................................................................................ 23
Troubleshooting ................................................................................................................................ 24
Packaging ............................................................................................................................24
Excision ............................................................................................................................... 24
Preparation of Media and Reagents................................................................................................ 25
References .......................................................................................................................................... 27
Endnotes............................................................................................................................................. 27
MSDS Information............................................................................................................................ 27
Lambda ZAP-CMV RI Predigested Vector Kit
ATERIALS PROVIDED
M
Materials provided Quantity
Lambda ZAP-CMV RI vector digested with EcoR I and CIAP treateda 10 μg
RHEO test insert digested with EcoR I 1.25 μg
XL1-Blue MRF´ strainb 0.5-ml bacterial glycerol stock
XLOLR strainb 0.5-ml bacterial glycerol stock
ExAssist interference-resistant helper phage
R408 Interference-Resistant Helper Phage
a
On arrival, store the Lambda ZAP-CMV RI vector at –20°C. After thawing, aliquot and store at –20°C. Do not pass
through more than two freeze–thaw cycles. For short-term storage, store at 4°C for 1 month.
b
Use the XLOLR strain for plating excised phagemids and the XL1-Blue MRF´ strain for all other manipulations. For host
strain shipping and storage conditions, see Bacterial Host Strains.
c
The titer of the ExAssist interference-resistant helper phage is ~1.0 × 1010 pfu/ml. This supercoiled single-stranded DNA
migrates at ~5 kb on an agarose gel. ExAssist helper phage is recommended for excision of the pCMV-Script EX
phagemid vector from the Lambda ZAP-CMV RI vector. It should not be used for single-stranded rescue.
d
Retiter after 1 month. (Take care not to contaminate the Lambda ZAP-CMV RI vector with this high-titer filamentous helper
phage.) Store at –80°C.
e
The titer of the R408 interference-resistant helper phage is ~7.5 × 1010 pfu/ml. This supercoiled single-stranded DNA
migrates at ~4 kb on an agarose gel. The R408 interference-resistant helper phage is recommended for single-stranded
rescue (see Appendix: Recovery of Single-Stranded DNA from Cells Containing the pCMV-Script EX Phagemid Vector).
c,d
1 ml
d,e
1 ml
STORAGE CONDITIONS
Lambda ZAP-CMV RI Vector: –20°C
Test Insert: –20°C
Helper Phage: –80°C
Bacterial Glycerol Stocks: –80°C
ADDITIONAL MATERIALS REQUIRED
Gigapack III Plus or Gigapack III Gold packaging extract (Stratagene Catalog #200204 and
#200201, respectively)
NOTICE TO PURCHASER
The use of the CMV Promoter is covered under U.S. Patent Nos. 5,168,062 and 5,385,839 owned by
the University of Iowa Research Foundation and licensed FOR RESEARCH USE ONLY. For
further information, please contact UIRF at 319-335-4546.
Revision A © Agilent Technologies, Inc. 2008.
Lambda ZAP-CMV RI Predigested Vector Kit 1
INTRODUCTION
Overview of the Lambda ZAP-CMV RI Vector System
The Lambda ZAP-CMV RI vector (predigested with EcoR I) allows
eukaryotic expression.
CMV RI vector, Sac I, Not I, Srf I, EcoR I, and Xho I, accommodate DNA
inserts up to 6.5 kb in length (see Figure 1). Inserts cloned into the Lambda
ZAP-CMV RI vector can be excised out of the phage in the form of the
kanamycin-resistant pCMV-Script
the same excision mechanism used with the Lambda ZAP vectors.
Clones in the Lambda ZAP-CMV RI vector can be screened with DNA
probes and in vivo rapid excision of the pCMV-Script EX phagemid vector
allows insert characterization in a plasmid system. Alternatively, the entire
library can be mass excised for functional screening in mammalian cells.
The polylinker of pCMV-Script EX phagemid has 15 unique cloning sites
flanked by T3 and T7 promoters and has three primer sites for DNA
sequencing. The plasmid has the bacteriophage f1 origin of replication
allowing rescue of single-stranded DNA, which can be used for DNA
sequencing or site-directed mutagenesis. Unidirectional deletions can be
made using exonuclease III and mung bean nuclease by taking advantage of
the unique positioning of 5´ and 3´ restriction sites. Transcripts made from
the T3 and T7 promoters generate riboprobes useful in Southern and
Northern blotting.
1, 2
The five unique cloning sites of the Lambda ZAP-
EX phagemid vector (see Figure 2) by
1, 3, 4
Note The pCMV-Script EX vector differs from the pCMV-Script vector
by 29 bases located downstream of the f1 origin.
Eukaryotic expression of inserts in pCMV-Script EX is driven by the
cytomegalovirus (CMV) immediate early (IE) promoter with the
SV40 transcription terminator and polyadenylation signal. Stable selection
of clones in eukaryotic cells is made possible by the presence of the
neomycin-and kanamycin-resistance gene, which is driven by the
SV40 early promoter with TK transcription polyadenylation signals to
render transfectants resistant to G418 (geneticin).
The pCMV-Script EX vector does not contain an ATG initiation codon. A
translation initiation sequence must be incorporated if the DNA fragment to
be cloned does not have an initiating ATG codon or an optimal sequence for
initiating translation, such as the Kozak sequence [GCC(A/G)CCATGG].
Lambda ZAP-CMV Vector Map
FIGURE 1 Map of the Lambda ZAP-CMV vector.
2 Lambda ZAP-CMV RI Predigested Vector Kit
pCMV-Script EX Vector Map
A
pUC ori
TK pA
pCMV-Script EX
4.3 kb
neo/kan
pCMV-Script EX Multiple Cloning Site Region
(sequence shown 620–799)
T3 promoter
AATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTC CACCGCGGTGGCGGCCGCTCTA...
P CMV
MCS
SV40 pA
f1 ori
P bla
P SV40
Not ISac IIBstX ISac I
Srf I Pst I
...GCCCGGGCGGATCCCCCGGGCTGCAG GAATTCGATATCAAGCTTATCGATACCGTCGAC...
Xho I
...CTCGAGGGGGGGCCCGGTACCAGGTA AGTGTACCCAATTCG CCCCTATAGTGAGTCGTATTA
BamH I
pa I
Kpn I
EcoR I
EcoR V
Acc I/Sal IHind III
T7 promoter
Feature Nucleotide Position
CMV promoter 1–602
T3 promoter and T3 primer binding site 620–639
multiple cloning site 651–758
T7 promoter and T7 primer binding site 778–799
SV40 polyA signal 811–1194
f1 origin of ss-DNA replication 1332–1638
bla promoter 1692–1816
SV40 promoter 1836–2174
neomycin/kanamycin resistance ORF 2209–3000
HSV-thymidine kinase (TK) polyA signal 3001–3450
pUC origin 3588–4255
Figure 2 Circular map and polylinker sequence of the pCMV-Script EX vector.
Lambda ZAP-CMV RI Predigested Vector Kit 3
BACTERIAL HOST STRAINS
Host Strain Genotypes
Host strain Genotype
XL1-Blue MRF´ strain Δ(mcrA)183 Δ(mcrCB-hsdSMR-mrr)173 endA1 supE44 thi-1
recA1 gyrA96 relA1 lac [F´ proAB lacI
XLOLR straina Δ(mcrA)183 Δ(mcrCB-hsdSMR-mrr)173 endA1 thi-1 recA1
gyrA96 relA1 lac [F´ proAB lacIqZΔM15 Tn10 (Tetr)] Su–
(nonsuppressing) λ
a
Use the XLOLR strain for excision only.
XL1-Blue MRF´ Bacterial Strain Description
The RecA– E. coli host strain XL1-Blue MRF´ is supplied with the Lambda
ZAP-CMV RI predigested vector kit.
phagemid vector does not require a supF genotype, the amplified library
grows very efficiently on the XL1-Blue MRF´ strain. In addition, use of the
correct host strain is important when working with the pCMV-Script EX
phagemid vector due to the F´ episome present in the XL1-Blue MRF´
strain.
The F´ episome expresses the genes forming the F´ pili found on the surface
of the bacteria. Without pili formation, filamentous phage (i.e., M13 or f1)
infection could not occur. Because the conversion of a recombinant
ZAP-CMV RI clone to a pCMV-Script EX phagemid vector requires
superinfection with a filamentous helper phage, the F´ episome is required
for in vivo excision (see In Vivo Excision of the pCMV-Script EX Phagemid
Vector from the Lambda ZAP-CMV RI Vector).
q
ZΔM15 Tn10 (Tetr)]
r
(lambda resistant)
2
Because the pCMV-Script EX
Note The strains Y1088, Y1089, and Y1090 are not suitable for use with
the Lambda ZAP-CMV RI vector as these strains contain the
plasmid pMC9, a pBR322 derivative, which contains many of the
same sequences as those found in the phagemid portion of the
Lambda ZAP-CMV RI vector. Using these strains with the Lambda
ZAP-CMV RI vector could result in recombination between the
homologous sequences. The SURE and SOLR strains are not
compatible with the Lambda ZAP-CMV RI system since these
strains contain the kanamycin-resistance gene found in the
pCMV-Script EX phagemid vector.
4 Lambda ZAP-CMV RI Predigested Vector Kit
Recommended Media
Host strain
XLOLR strain LB-tetracyclinea LB broth with supplements
XL1-Blue MRF´ strain LB-tetracyclinea LB broth with supplements
a
See Preparation of Media and Reagents.
b
LB broth with 0.2% (w/v) maltose and 10 mM MgSO4.
c
Maltose and magnesium supplements are required for optimal lambda phage receptor expression on the surface of the
XL1-Blue MRF´ host cell. The media supplements are not required for helper phage infection, but are included in both
protocols for simplified media preparation.
Agar plates and
liquid medium for
bacterial streak
and glycerol stock
Liquid medium for
bacterial cultures prior to
phage attachment
a-c
a-c
Agar plates
and top agar
for plaque
formation
— LB-kanamycina
NZYa —
Agar plates for
excision protocol
Establishing an Agar Plate Bacterial Stock
The bacterial host strains are shipped as bacterial glycerol stocks. On arrival,
prepare the following plates from the bacterial glycerol stocks.
Note The host strains may thaw during shipment. The vials should be
stored immediately at –20° or –80°C, but most strains remain
viable longer if stored at –80°C. It is best to avoid repeated
thawing of the host strains in order to maintain extended viability.
1. Revive the stored cells by scraping off splinters of solid ice with a
sterile wire loop.
2. Streak the splinters onto an LB agar plate containing the appropriate
antibiotic (see Recommended Media), if one is necessary.
3. Incubate the plate overnight at 37°C.
4. Seal the plate with Parafilm
®
for up to 1 week.
5. Restreak the cells onto a fresh plate every week.
Preparing a –80°C Bacterial Glycerol Stock
1. In a sterile 50-ml conical tube, inoculate 10 ml of LB broth with the
appropriate antibiotic (see Recommended Media) with one colony from
the plate. Grow the cells to late log phase.
2. Add 4.5 ml of a sterile glycerol-liquid medium solution (prepared by
mixing 5 ml of glycerol + 5 ml of the appropriate medium) to the
bacterial culture from step 1. Mix well.
3. Aliquot into sterile centrifuge tubes (1 ml/tube).
This preparation may be stored at –20°C for 1–2 years or at –80°C for more
than 2 years.
laboratory film and store the plate at 4°C
Lambda ZAP-CMV RI Predigested Vector Kit 5
Growth of Cells for Plating Phage
Bacterial cultures for plating phage should be started from a fresh plate
using a single colony and should be grown overnight with vigorous shaking
at 30°C in 50 ml of LB broth supplemented with 0.2% (w/v) maltose and
10 mM MgSO
The lower temperature ensures that the cells will not overgrow. The cells
should be spun at 1000 × g for 10 minutes then gently resuspended in
10 ml of 10 mM MgSO
10 mM MgSO
phage manipulations described within the manual. Highest efficiencies are
obtained from freshly prepared cells.
HELPER PHAGE
Two different helper phages are provided with the Lambda ZAP-CMV RI
predigested vector kit: (1) the ExAssist interference-resistant helper phage
with XLOLR strain and (2) the R408 helper phage. The ExAssist
interference-resistant helper phage with XLOLR strain is designed to allow
efficient in vivo excision of the pCMV-Script EX phagemid vector from the
Lambda ZAP-CMV RI vector while preventing problems associated with
helper phage co-infection. The ExAssist helper phage contains an amber
mutation that prevents replication of the phage genome in a nonsuppressing
E. coli strain (e.g., XLOLR cells). Only the excised phagemid can replicate
in the host, removing the possibility of co-infection from the ExAssist
helper phage. Because ExAssist helper phage cannot replicate in the
XLOLR strain, single-stranded rescue cannot be performed in this strain
using ExAssist helper phage. XLOLR cells are also resistant to lambda
infection, preventing lambda DNA contamination after excision.
. (Do not use tetracycline in the presence of magnesium.)
4
. Before use, dilute cells to an OD
4
. Bacterial cells prepared in this manner can be used for all
4
of 0.5 with
600
Storing the Helper Phage
The ExAssist helper phage and the R408 helper phage are supplied in
7% dimethylsulfoxide (DMSO) and should be stored at –80°C. The helper
phage may be stored for short periods of time at –20°C or 4°C. It is
important to titer the helper phage prior to each use. Expect titers of
approximately 10
the R408 helper phage. If the titer drops over time, prepare a fresh high-titer
stock of the helper phage as outlined in Amplifying the Helper Phage.
Titering the Helper Phage
1. Transfer a colony of XL1-Blue MRF´ cells into 10 ml of LB broth with
supplements in a 50-ml conical tube. Incubate the conical tube with
shaking at 37°C until growth reaches an OD
2. Dilute the phage (10
and Reagents) and combine 1 μl of each dilution with 200 μl of
XL1-Blue MRF´ cells (OD
3. Incubate the helper phage and the XL1-Blue MRF´ cells for 15 minutes
at 37°C to allow the phage to attach to the cells.
10
pfu/ml for the ExAssist helper phage or 1010 pfu/ml for
of 1.0.
600
–4
–10–7) in SM buffer (See Preparation of Media
= 1.0).
600
6 Lambda ZAP-CMV RI Predigested Vector Kit
Loading...