Lexogen QuantSeq User Manual

Page 1

3‘ mRNA-Seq Library Prep Kit

User Guide

Catalog Numbers: 015 (QuantSeq 3‘ mRNA-Seq Library Prep Kit for Illumina (FWD)) 016 (QuantSeq 3‘ mRNA-Seq Library Prep Kit for Illumina (REV) with Custom Sequencing Primer)

015UG009V0252

Page 2

001UI182V0100

ATTENTION: Updated Sequencing Guidelines for Lexogen Libraries

We do not recommend multiplexing Lexogen libraries with libraries from other vendors in the same sequencing lane.

Though this is possible in principle, speciﬁc optimization of index combinations, library pooling conditions, and loading amounts may be required, even for advanced users. Sequencing complex pools that include diﬀerent library types at diﬀerent lane shares may have unpredictable eﬀects on sequencing run metrics, read quality, read outputs, and/or demultiplexing performance. Lexogen assumes no responsibility for the altered performance of Lexogen libraries sequenced in combination with external library types in the same lane (or run).

Due to size dierences, libraries prepared with the Lexogen Small RNA-Seq Library Prep Kit (or any other small RNA library prep kit) should not be sequenced together with QuantSeq, QuantSeq-Flex or SENSE libraries.

Please refer to the sequencing guidelines for each library type (library adapter details, loading amounts to use, and use of custom sequencing primers, etc), which are provided in our Library Prep Kit User Guides, and online Frequently Asked Questions (FAQs).

These recommendations are current as of August 13, 2018. For further information or inquiries please contact info@lexogen.com.

Page 3

015UI092V0321

Important recommendations for QuantSeq 3’ mRNA Library Prep

Critical Steps for QuantSeq 3’ mRNA-Seq Library Prep Kits!

First Strand cDNA Synthesis (p.11-12):

1. At step 3 pre-warm the FS2 / E1 mastermix for 2 - 3 minutes at 42 °C. Do not cool the mastermix on ice!

2. Have the RNA / FS1 samples at 42 °C when adding the pre-warmed FS2 / E1 mastermix (step

) and mix properly when adding. Any drop in temperature at this point can cause mishybrid-

ization. Seal the plate or tubes and begin the 42 °C incubation.

3. Spin down the samples at room temperature before and after adding the FS2 / E1 mastermix.

If step 2 is skipped for low input or degraded samples (≤10 ng, or FFPE samples):

1. Prepare your RNA samples in 5 μl volumes.

2. Prepare a mastermix containing 5 μl FS1, 9.5 μl FS2, and 0.5 μl E1, mix well, spin down, and pre-warm at 42 °C on a thermocycler for 2 - 3 minutes.

3. Bring your RNA samples to room temperature while the mastermix is pre-warming.

4. Spin down the pre-warmed FS1 / FS2 / E1 mastermix and add 15 μl to each RNA sample. Mix, seal the plate or strip-tubes, spin down briefly at room temperature, and then commence the 42 °C incubation for 15 minutes (or 1 hour for low input RNA (≤ 10 ng)).

5. Proceed immediately to RNA Removal.

Protocol modifications for low input (≤ 10 ng), FFPE, or low quality / degraded RNA versus standard RNA input:

Protocol

Step

Add FS1 to RNA samples. Do not place

samples back on ice after adding FS1 !

Incubate for 3 minutes at 85 °C, then cool

to 42 °C. Hold samples at 42 °C on the thermocycler.

Prepare FS2 / E1 mastermix – pre-warm for

2 - 3 minutes at 42 °C.

Add pre-warmed mastermix to RNA / FS1

samples on the thermocycler at 42 °C. Incubate for 15 minutes at 42 °C.

Standard Input

(>10 ng)

Low Input (≤10 ng)*

FFPE / Degraded RNA

Skip denaturation step! Place RNA samples brieﬂy at

room temperature while the mastermix is prepared.

Prepare FS1 / FS2 / E1 mastermix – pre-warm for 2 - 3 minutes at 42 °C.

Add pre-warmed mastermix to RNA samples at room temperature and transfer to a thermocycler preheated to 42 °C. Incubate for 15 minutes at 42 °C, or increase incubation time to 1 hour.

Low Input (≤1 ng)*

Turn me over

Page 4

Protocol

Step

Standard Input

(>10 ng)

Low Input (≤10 ng)*

FFPE / Degraded RNA

Low Input (≤1 ng)*

Step

*Only for QuantSeq FWD. Minimum input for QuantSeq REV is 10 ng.

Incubate for 10 minutes at 95 °C.

Add 56 μl of Puriﬁcation Solution (PS). Reduce volume of Puriﬁcation Solution (PS) to 48 μl.

The qPCR assay is strongly recommended for optimizing the number of PCR cycles required for library ampliﬁcation. This will prevent under- or overcycling of the libraries (see Appendix E, p.25). The qPCR assay should be performed also when RNA samples are of:

• Variable input amount

• Variable quality (RIN / RQN) or purity (absorbance ratios: 260/280 and 260/230)

• Variable type (e.g., species, tissue, cell type)

• FFPE origin, or highly degraded

Add 30 μl of Puriﬁcation Beads (PB) for

single-indexed libraries, or 35 μl for dual-indexed libraries.

Incubate for 10 minutes at 95 °C.

Reduce volume of Puriﬁcation Beads (PB) to 27 μl for single-indexed libraries, or 31.5 μl for dual-indexed libraries.

Incubate for 5 minutes at 95 °C.

Sequencing Recommendations for QuantSeq Libraries

Loading amounts and general sequencing recommendations for QuantSeq FWD and REV libraries for Illumina instruments, can be found in our online FAQs (QuantSeq FWD: 1.24, and QuantSeq REV:

1.26) at https://www.lexogen.com/quantseq-3mrna-sequencing/.

For further details please check the revision history at the end of this User Guide, or contact Lexogen support: support@lexogen.com, or +43 1345 1212-41.

Page 5

FOR RESEARCH USE ONLY. NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE.

INFORMATION IN THIS DOCUMENT IS SUBJECT TO CHANGE WITHOUT NOTICE. Lexogen does not assume any responsibility for errors that may appear in this document.

PATENTS AND TRADEMARKS

The QuantSeq 3‘ mRNA-Seq Library Prep Kits are covered by issued and/or pending patents. QuantSeq™ and SIRV™ are trademarks of Lexogen. The SIRVs are covered by issued and/or pending patents. Lexogen UDI 12 nt Unique Dual Index design and UDI sequences are covered by issued and/or pending patents. Lexogen is a registered trademark (EU, CH, USA). RNasin® is a registered trademark of Promega Corporation. Bioanalyzer®, Fragment Analyzer™, and TapeStation® are trademarks of Agilent Technologies, Inc.; SYBR® Green I is a registered trademark of Molecular Probes, Inc.; LabChip® GX II is a registered trademark of Perkin Elmer. RNaseZap™, RNAlater®, and ERCC are registered trademarks of Ambion, Inc.; ThermoMixer® is a registered trademark of Eppendorf AG. Qubit™ and NanoDrop™ are registered trademarks of Thermo Fisher Scientiﬁc. Illumina®, HiSeq®, and MiSeq® are registered trademarks, and NextSeq™, NovaSeq™ and MiniSeq™ are trademarks of Illumina, Inc.

All other brands and names contained in this user guide are the property of their respective owners.

Lexogen does not assume responsibility for patent infringements or violations that may occur with the use of its products.

LIABILITY AND LIMITED USE LABEL LICENSE: FOR RESEARCH USE ONLY

This document is proprietary to Lexogen. The QuantSeq kits are intended for use in research and development only. They need to be handled by qualiﬁed and experienced personnel to ensure safety and proper use. Lexogen does not assume liability for any damage caused by the improper use or the failure to read and explicitly follow this user guide. Furthermore, Lexogen does not assume warranty for merchantability or suitability of the product for a particular purpose.

The purchase of the product is subject to Lexogen general terms and conditions (www.lexogen.com/

terms-and-conditions/) and does not convey the rights to resell, distribute, further sub-license, repackage,

or modify the product or any of its components. This document and its content shall not be used or distributed for any other purpose and/or otherwise communicated, disclosed, or reproduced in any way without the prior written consent of Lexogen. For information on purchasing additional rights or a license for use other than research, please contact Lexogen.

WARRANTY

Lexogen is committed to providing excellent products. Lexogen warrants that the product performs to the standards described in this user guide up to the expiration date. Should this product fail to meet these standards due to any reason other than misuse, improper handling, or storage, Lexogen will replace the product free of charge or issue a credit for the purchase price. Lexogen does not provide any warranty if product components are replaced with substitutes.

Under no circumstances shall the liability of this warranty exceed the purchase price of this product. We reserve the right to change, alter, or modify any product without notice to enhance its performance.

LITERATURE CITATION

For any publication using this product, please refer to it as Lexogen‘s QuantSeqTM 3‘ mRNA-Seq Kit.

CONTACT INFORMATION

Lexogen GmbH Support

Campus Vienna Biocenter 5 E-mail: support@lexogen.com 1030 Vienna, Austria Tel. +43 (0) 1 3451212-41 www.lexogen.com Fax. +43 (0) 1 3451212-99 E-mail: info@lexogen.com

Page 6

Table of Contents

1. Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 4

2. Kit Components and Storage Conditions . . . . . . . . . . . . . . 6

3. User-Supplied Consumables and Equipment . . . . . . . . . . . 7

4. Guidelines . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 8

5. Detailed Protocol . . . . . . . . . . . . . . . . . . . . . . . . . . . 11

5.1 Library Generation . . . . . . . . . . . . . . . . . . . . . . . 11

5.2 Library Ampliﬁcation - Single Indexing (i7 only) . . . . . 15

6. Short Procedure . . . . . . . . . . . . . . . . . . . . . . . . . . . 18

7. Appendix A: General RNA Requirements . . . . . . . . . . . . 20

8. Appendix B: RNA Input and PCR Cycles . . . . . . . . . . . . . 22

9. Appendix C: Low Input RNA . . . . . . . . . . . . . . . . . . . . 23

10. Appendix D: Low Quality RNA - FFPE. . . . . . . . . . . . . . . 24

11. Appendix E: qPCR . . . . . . . . . . . . . . . . . . . . . . . . . . 25

12. Appendix F: Library Reampliﬁcation . . . . . . . . . . . . . . . 27

13. Appendix G: Library Quality Control. . . . . . . . . . . . . . . . 28

14. Appendix H: Modulating Insert Sizes . . . . . . . . . . . . . . . 30

15. Appendix I: Globin Block Modules for QuantSeq . . . . . . . . 31

16. Appendix J: Unique Molecular Identiﬁers. . . . . . . . . . . . . 33

17. Appendix K: Multiplexing . . . . . . . . . . . . . . . . . . . . . . 35

18. Appendix L: Sequencing. . . . . . . . . . . . . . . . . . . . . . . 38

19. Appendix M: Data Analysis. . . . . . . . . . . . . . . . . . . . . 42

20. Appendix N: Automation . . . . . . . . . . . . . . . . . . . . . . 45

21. Appendix O: Revision History . . . . . . . . . . . . . . . . . . . 46

Page 7

1. Overview

Lexogen’s QuantSeq 3’ mRNA-Seq Kits provide library preparation protocols that generate Illumina-compatible libraries from polyadenylated RNA within 4.5 hours. The QuantSeq protocol generates only one fragment per transcript, resulting in extremely accurate gene expression values, and the sequences obtained are close to the 3’ end of the transcripts.

QuantSeq is available with two read directions, forward (FWD) and reverse (REV). QuantSeq Forward (FWD, Cat. No. 015) contains the Read 1 linker sequence in the second strand synthesis primer, hence NGS reads are generated towards the poly(A) tail and directly correspond to the mRNA sequence. To pinpoint the exact 3’ end, longer reads may be required. Although paired-end sequencing is possible, we do not recommend it for QuantSeq FWD. Read 2 would start with the poly(T ) stretch, and sequence through the homopolymer stretch, reducing the quality of Read 2. For QuantSeq Reverse (REV, Cat. No. 016) the Read 1 linker sequence is introduced by the oligodT primer. Here, a Custom Sequencing Primer (CSP Version 5, included in the kit) is required for Read

1. The sequence generated during Read 1 corresponds to the cDNA. QuantSeq REV can be used for

paired-end sequencing, ensuring the CSP is used for Read 1. With QuantSeq REV the exact 3’ end is pinpointed in Read 1.

Both QuantSeq FWD and REV maintain strand-speciﬁcity and allow mapping of reads to their corresponding strand on the genome, enabling the discovery and quantiﬁcation of antisense transcripts and overlapping genes. The kits include magnetic beads for the puriﬁcation steps and hence are compatible with automation. Multiplexing of libraries can be carried out using up to 96 i7 indices (included). Additional i5 6 nt Dual Indexing Add-on Kits (Cat. No. 047) are also available for preparing and multiplexing up to 9,216 uniquely-barcoded libraries. QuantSeq Library Prep Kits (FWD and REV) are also compatible with UDI 12 nt Unique Dual Indexing Add-on Kits (Cat. No. 107-111, 120). For convenience, Quant-Seq 3’ FWD Library Prep Kits with Unique Dual Indices are also available (Cat. No. 113-115, 129-131).

QuantSeq uses total RNA as input, hence no prior poly(A) enrichment or rRNA depletion is required. Information on input requirements can be found in Appendix A, p.20. Library generation is initiated by oligodT priming (Fig. 1). The primer already contains partial Illumina-compatible linker sequence. After ﬁrst strand synthesis the RNA is removed and second strand synthesis is initiated by random priming. The random primer also contains Illumina-compatible linker sequence. No puriﬁcation is required between ﬁrst and second strand synthesis. The insert size is optimized for shorter read lengths: SR50 - 100 (FWD and REV) or PE50 - 100 (REV). Second strand synthesis is followed by a magnetic bead-based puriﬁcation step. The library is then ampliﬁed, introducing the sequences required for cluster generation. i7 indices for multiplexing are included in all QuantSeq kits and are introduced during the PCR ampliﬁcation step.

Appendices B - L (p.22 - 41) contain additional information on protocol modiﬁcations, PCR cycle optimization by qPCR assay, quality control, add-on modules, multiplexing, and sequencing guidelines. An automated QuantSeq bioinformatics pipeline has been integrated on the Bluebee® Genomics Analysis Platform and each purchased QuantSeq kit includes a code for free data analysis on this platform (see also Appendix M, p.42). For more details visit our webpage at www.lexogen.com.

4 LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 8

LIBRARY GENERATION

3.3 hrs 1 hr

Reverse Transcription

(oligodT priming)

RNA Removal

Second Strand

Synthesis

Purification

PCR

Purification

(optional)

index

Index 2 (i5) Sequencing

Primer

Sequencing

Primer

Poly(A)

RNA

5’

Removal of RNA template

5’ 3’

Random priming

3’

5’

Tagged cDNA library

Double-stranded cDNA library

LIBRARY AMPLIFICATION

cDNA library with adapters for Illumina

sequencing

i5 index (optional)

SEQUENCING - Read orientation for QuantSeq FWD

NBAAAAA.....AAAAAA

3’

i7 index

Index 1 (i7) Sequencing

Primer

Read 2 Sequencing Primer

(not recommended)

(AAAAAAAA)

3’

(TTTTTTTTT)

5’

(AAAAAAAA)

3’

5’

1.2 hrs 45 min

index

SEQUENCING - Read orientation for QuantSeq REV

Read 2 Sequencing

Primer

.....

NV TTTT

index

Index 1 (i7) Sequencing

Primer

TTTTTTT

Read 1 Sequencing Primer (CSP, included)

index

(optional)

Index 2 (i5) Sequencing

Primer

Figure 1. Schematic overview of the QuantSeq FWD library preparation workﬂow (Cat. No. 015). For QuantSeq REV (Cat. No. 016) the position of adapters for Read 1 (green) and Read 2 (blue) are switched. Sequencing read orientation for QuantSeq FWD and QuantSeq REV is depicted as well. For QuantSeq FWD, Read 1 reﬂects the mRNA sequence. Paired-end sequencing is not recommended for QuantSeq FWD. QuantSeq REV is suitable for paired-end sequencing, and Read 1 reﬂects the cDNA sequence. A Custom Sequencing Primer (CSP Version 5, included in the kit) is required for Read 1.

5LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 9

2. Kit Components and Storage Conditions

Lexogen i7 6 nt Index Set (-20 oC)Reagent Box (-20 oC) Purication Module 022 (+4

1 2 3 4 5 6 7 8 9 10 11 12

FS1

FS2

Figure 2. Location of kit components. For the 24 prep kit the Lexogen i7 6 nt Index Set is only ﬁlled with indices 7001-7024 (up to the blue dotted line). CSP (red lid color) is only required and included for QuantSeq REV (Cat. No. 016.24, Cat. No. 016.96, Cat. No. 016.2x96). All kits include Puriﬁcation Modules.

Kit Component Tube Label

First Strand cDNA Synthesis Mix 1 FS1 132 µl 528 µl -20 °C

First Strand cDNA Synthesis Mix 2 FS2 250.8 µl 1,003.2 µl -20 °C

Enzyme Mix 1 E1 13.2 µl 52.8 µl -20 °C

RNA Removal Solution

Second Strand Synthesis Mix 1 SS1 264 µl 1056 µl -20 °C

Second Strand Synthesis Mix 2 SS2 105.6 µl 422.4 µl -20 °C

Enzyme Mix 2 E2 26.4 µl 105.6 µl -20 °C

PCR Mix PCR 184.8µl 739.2 µl -20 °C

Enzyme Mix 3 E3 26.4 µl 105.6 µl -20 °C

Lexogen i7 6 nt Index Set (96-well plate) 5 µl / reaction -20 °C

Custom Sequencing Primer Version 5 (100 µM)** CSP 25 µl 50 µl -20 °C

Purication Module (Cat. No. 022) included in the kit

Purication Beads PB 1,320 µl 5,280 µl +4 °C

Purication Solution PS 2,693 µl 10,772 µl +4 °C

Elution Buer EB 2,904 µl 11,616 µl +4 °C

** only required for QuantSeq REV (Cat. No. 016)

RS SS1

SS2

PCR

CSP

24 preps

Volume* Storage

24 preps 96 preps

132 µl 528 µl -20 °C

*including ≥10 % surplus

EBPB

Upon receiving the QuantSeq kit, store the Puriﬁcation Module (Cat. No. 022), containing PB, PS, and EB at +4 °C, and the rest of the kit in a -20 °C freezer. NOTE: Before use, check the contents of PS. If a precipitate is visible, incubate at 37 °C until buﬀer components dissolve completely.

ATTENTION: The Custom Sequencing Primer Version 5 (CSP ) is only required for QuantSeq

REV (Cat. No. 016) libraries. CSP has to be provided to the sequencing facility together with the lane mix. For further details on the usage of the CSP see Appendix L, p.38. Forward this

information to your sequencing facility before starting a sequencing run.

6 LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 10

3. User-Supplied Consumables and Equipment

Check to ensure that you have all of the necessary material and equipment before beginning the library preparation. All reagents, equipment, and labware must be free of nucleases and nucleic acid contamination.

Reagents / Solutions

• 80 % fresh ethanol (for washing of Puriﬁcation Beads, PB).

• Lexogen PCR Add-on Kit for Illumina (Cat. No. 020), for qPCR assay.

• SYBR Green I (Sigma-Aldrich, Cat. No. S9430 or ThermoFisher, Cat. No. S7585), diluted to 2.5x in

DMSO, for qPCR assay.

Equipment

• Magnetic plate e.g., 96S Super Magnet Plate, article# A001322 from Alpaqua.

• Benchtop centrifuge (3,000 x g, rotor compatible with 96-well plates).

• Calibrated single-channel pipettes for handling 1 µl to 1,000 µl volumes.

• Calibrated multi-channel pipettes for handling 1 µl to 200 µl volumes.

• Thermocycler.

• UV-spectrophotometer to quantify RNA.

• Ice bath or ice box, ice pellets, benchtop cooler (-20 °C for enzymes).

Labware

• Suitable certiﬁed ribonuclease-free low binding pipette tips (pipette tips with aerosol barriers

recommended).

• 1.5 ml reaction tubes, low binding, certiﬁed ribonuclease-free.

• 200 µl PCR tubes or 96-well plates and caps or sealing foil.

• Vortex mixer.

Optional Equipment

• Automated microﬂuidic electrophoresis station (e.g., Agilent Technologies, Inc., 2100 Bioanalyzer).

• qPCR machine and library standards (for library quantiﬁcation).

• Benchtop ﬂuorometer and appropriate assays (for RNA quality control and library quantiﬁcation).

• Agarose gels, dyes, and electrophoresis rig (for RNA quality control).

The complete set of material, reagents, and labware necessary for RNA extraction and quality

control is not listed. Consult Appendix A, p.20 and Appendix D, p.24, for more information

on RNA quality. Consult Appendix G, p.28 for information on library quantiﬁcation methods.

7LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 11

4. Guidelines

RNA Handling

• RNases are ubiquitous, and special care should be taken throughout the procedure to avoid

RNase contamination.

• Use commercial ribonuclease inhibitors (i.e., RNasin, Promega Corp.) to maintain RNA integ-

rity when storing samples.

• Use a sterile and RNase-free workstation or laminar ﬂow hood if available. Please note that

RNases may still be present on sterile surfaces, and that autoclaving does not completely

eliminate RNase contamination. Well before starting a library preparation, clean your work

space, pipettes, and other equipment with RNase removal spray (such as RNaseZap, Ambi-

on Inc.) as per the manufacturer’s instructions. ATTENTION: Do not forget to rinse oﬀ any

RNaseZap residue with RNase-free water after usage. Residues of RNaseZap may damage

the RNA.

• Protect all reagents and your RNA samples from RNases on your skin by wearing a clean

lab coat and fresh gloves. Change gloves after making contact with equipment or surfaces

outside of the RNase-free zone.

• Avoid speaking above opened tubes. Keep reagents closed when not in use to avoid air-

borne RNase contamination.

Bead Handling

• Beads are stored at +4 °C and must be resuspended before usage. Beads can be resuspend-

ed by pipetting up and down several times or by vortexing. When properly resuspended,

the solution should have a uniform brown color with no visible clumping on the walls or

bottom of the tube or storage bottle.

• Beads may stick to certain pipette tips, in which case removing the beads from the inside

of the tip may be impossible. Avoid resuspending by repeated pipetting and instead resus-

pend by vortexing if this occurs with your tips.

• Beads are superparamagnetic and are collected by placing the plate / tube in a magnetic

plate or stand. The time required for complete separation will vary depending on the strength

of your magnets, wall thickness of the wells / tubes, viscosity of the solution, and the proximity

of the well / tube to the magnet. Separation time may need to be adjusted accordingly. When

fully separated, the supernatant should be completely clear and the beads collected at one

point or as a ring along the wall of the well / tube, depending on the magnet that was used.

• To remove the supernatant the plate / tube containing the beads has to stay in close contact with

the magnet. Do not remove the plate / tube from the magnetic plate / stand when removing

8 LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 12

the supernatant, as the absence of the magnet will cause the beads to go into suspension again.

• When using a multichannel pipette to remove the supernatant, make sure not to disturb the

beads. If beads were disturbed, ensure that no beads are stuck to the pipette tip opening

and leave the multichannel pipette in the well for an extra 30 seconds before removing the

supernatant. This way all beads can be recollected at the magnet and the clear supernatant

can be removed.

• In general, beads should not be centrifuged during the protocol. However, should drops of

ﬂuid stay on the wall of the reaction tube / plate (e.g., after mixing by vortexing), centrifuga-

tion at 2,000 x g for 30 seconds should be carried out before placing the tube / plate on the

magnetic stand / plate.

• Allowing the beads to dry out can damage them. Always keep the beads in suspension

except for the short period after withdrawing the supernatant, and before adding the next

reagent. Beads can be resuspended by vortexing, but make sure that beads are not deposit-

ed on the well / tube walls above the level of the liquid, where they can dry during incuba-

tion. If necessary, stuck beads can be collected by centrifuging the plate / tube brieﬂy with

a suitable benchtop centrifuge.

General

• Unless explicitly mentioned, all centrifugation steps should be carried out at room tempera-

ture (RT) between 20 °C and 25 °C. Results may be negatively impacted if the protocol is

performed at temperatures outside of this range. While reaction set-up is often performed at

RT, incubation temperatures are explicitly deﬁned, and must be strictly adhered to.

• Steps requiring a thermocycler have been tested with a maximum ramp speed of 5 °C/sec

before denaturation and extension, and 2.5 °C/sec during primer annealing. While these

ramp speeds are typical for most modern thermocyclers, some models can exceed these

rates, and ramp speed may need to be decreased to ensure eﬃcient annealing. Ramp

speeds may be reduced even further in some steps of the protocol to ensure better hybrid-

ization. Preheat lid to 105 °C, in case this has to be adjusted manually.

• Ensure that adequate volumes of all reagents and the necessary equipment are available

before beginning the protocol.

• Perform all pipetting steps with calibrated pipettes, and always use fresh tips. Pipette care-

fully to avoid foaming as some solutions contain detergents.

• Thaw all necessary buﬀers at room temperature or as indicated in the preparation tables

at the beginning of each step of the detailed protocol. Mix reagents well by vortexing or

pipetting repeatedly and centrifuge brieﬂy with a benchtop centrifuge to collect contents

before use.

• Keep Enzyme Mixes at -20 °C until just before use or store in a -20 °C benchtop cooler.

9LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 13

• When mixing by pipetting, set the pipette to a larger volume. For example after adding 5 µl

in steps 5 and 10 use a pipette set to 15 µl or 30 µl, respectively, to ensure proper mixing.

• To maximize reproducibility and avoid cross contamination spin down the reactions both af-

ter mixing, and after incubations at elevated temperatures (i.e., before removing the sealing

foil from PCR plates or tubes, e.g., step 2).

Pipetting and Handling of (Viscous) Solutions

• Enzyme Mixes, SS1 , PB, and PS are viscous solutions which require care to pipette accu-

rately. Quickly spin down the tubes to collect all liquid at the bottom of the tube. Be sure

to pipette slowly and check the graduation marks on your pipette tips when removing an

aliquot.

• When drawing up liquid, the tip should be dipped 3 to 5 mm below the surface of the liquid,

always at a 90 degree angle. Do not dip the tip in any further as viscous solutions tend to

stick to the outside of the pipette tip.

• Any residual liquid adhering to the tip should be removed by sliding the tip up the wall or

edge of the tube from which the liquid was taken. Spin down the tube afterwards again to

ensure that all liquid is collected at the bottom of the tube for further storage.

• When dispensing, the pipette should be held at a 45 degree angle, and the tip placed

against the side of the receiving vessel.

• When pipetting liquids from bottles, take special care that only the sterile pipette tip touch-

es the bottle opening to prevent introducing RNases or other contaminants. Tips are sterile,

whereas the pipette itself is not. If necessary, tilt the bottle to bring the liquid closer to the

opening and facilitate pipetting.

Preparation of Mastermixes and Pipetting with Multi-Channel Pipettes

In steps 3 , 9 , and 25 of the QuantSeq protocol mastermixes of enzymes and reaction buffers should be prepared. When preparing mastermixes and when using multi-channel pipettes always include a 10 % surplus per reaction in order to have enough solution available for all reactions.

EXAMPLE: Step 3 for 24 preps: use 250.8 µl FS2 (= 9.5 µl x 24 rxn x 1.1)

+ 13.2 µl E1 (= 0.5 µl x 24 rxn x 1.1) resulting in a total of 264 µl, which is suﬃcient for multi-channel pipetting. All reagents of the QuantSeq kit include at least 10 % surplus.

Automation

QuantSeq is compatible with automation on various platforms. For further information see

Appendix N, p.45, or contact us at support@lexogen.com.

10 LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 14

5. Detailed Protocol

5.1 Library Generation

Preparation

First Strand cDNA

Synthesis

FS1 – thawed at RT FS2 – thawed at RT E1 – keep on ice

or at -20 °C

85 °C, 3 min cool to 42 °C; 42 °C, 15 min

RNA Removal Second Strand Synthesis Purication

RS or RS-GB

95 °C, 10 min cool to 25 °C

thawed at RT

SS1 or USS

SS2 – thawed at RT E2 – keep on ice

or at -20 °C

98 °C, 1 min, then cool to 25 °C (0.5 °C/sec) 25 °C, 30 min; 25 °C, 15 min

thawed at 37 °C

PB – stored at +4 °C PS – stored at +4 °C 80 % EtOH – provided by user

prepare fresh!

EB – stored at +4 °C

Equilibrate all reagents to room temperature for 30 minutes prior to use.

First Strand cDNA Synthesis - Reverse Transcription

An oligodT primer containing an Illumina-compatible sequence at its 5’ end is hybridized to the RNA and reverse transcription is performed. To generate libraries with longer insert sizes, use the QuantSeq-Flex First Strand Synthesis Module (Cat. No. 026, Appendix H, p.30).

ATTENTION: Minimum recommended input amounts are: 100 pg for QuantSeq FWD Library

Prep, and 10 ng for QuantSeq REV. When using input amounts ≤1ng we recommend including a no-input control (see also Appendix B, p.22).

NOTE: Protocol modiﬁcations are recommended for low input (≤10 ng), low quality, and FFPE

RNA samples. These are indicated as ”REMARK” in the respective protocol steps (see also Appendix C, p.23, and Appendix D, p.24).

Mix 100 pg - 500 ng of total RNA in a volume of 5 µl, with 5 µl First Strand cDNA Synthesis Mix 1 (FS1 ) in a PCR plate. If necessary, adjust the total volume to 10 µl with RNase-free water. Mix well by pipetting. Ensure the plate is tightly sealed, and spin

down to collect the liquid at the bottom of the wells. REMARK: Skip this step for low input / low quality / FFPE RNA. Do not add FS1 to the RNA. Place the RNA samples brieﬂy at room temperature and proceed to step 3.

Denature the RNA / FS1 mix for 3 minutes at 85 °C in a thermocycler and then cool

down to 42 °C. ATTENTION: Leave the reactions at 42 °C until step 4. REMARK: Skip this step for low input / low quality / FFPE RNA.

11LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 15

Prepare a mastermix containing 9.5 µl First Strand cDNA Synthesis Mix 2 (FS2 ) and

0.5 µl Enzyme Mix 1 (E1 ) per reaction. Mix well, spin down, and pre-warm the mastermix for 2 - 3 minutes at 42 °C. REMARK: If step 2 is skipped, prepare a mas-

termix containing 5 µl First Strand cDNA Synthesis Mix 1 (FS1 ), 9.5 µl FS2 , and

0.5 µl E1 per sample. Mix well, spin down, and pre-warm for 2 - 3 minutes at 42 °C.

ATTENTION: Do not cool mastermixes on ice.

Quickly spin down the denatured RNA / FS1 samples from step 2 at room temperature to make sure all liquid is collected at the bottom of the wells. Place the samples back onto the thermocycler at 42 °C and carefully remove the sealing foil. Add 10 µl of the FS2 / E1 mastermix to each reaction, mix well, and seal the plate. Spin down briefly and incubate the reactions for 15 minutes at 42 °C. REMARK: If step 2 is skipped,

add 15 µl of the pre-warmed FS1 / FS2 / E1 mastermix to each 5 µl RNA sample, mix well, and seal the plate. Spin down briefly and incubate the reactions for 15 minutes at 42 °C. OPTIONAL: For low input / low quality / FFPE RNA, extend the incubation time to 1 hour at 42 °C. ATTENTION: Brieﬂy spin down the samples and proceed immediately to step 5. Do not cool the samples below room temperature after reverse transcription.

RNA Removal

During this step the RNA template is degraded. This is essential for eﬃcient second strand synthesis. Before removing the sealing foil after the ﬁrst strand synthesis reaction, quickly spin down the plate to make sure all liquid is collected at the bottom of the wells.

OPTIONAL: At step 5 , the Globin Block Modules for QuantSeq (RS-Globin Block, Homo sapiens

(RS-GBHs ), Cat. No. 070; and RS-Globin Block, Sus scrofa (RS-GBSs ), Cat. No. 071) can be used instead of the standard RNA Removal Solution (RS ) (see Appendix I, p.31). The use of Removal Solution-Globin Block (RS-GB ) prevents the generation of amplifiable library fragments from globin mRNAs, which are present in blood total RNA.

ATTENTION: Thaw RS-GB solutions at room temperature before use.

Add 5 µl RNA Removal Solution (RS ) or 5 µl Removal Solution-Globin Block (RS-GBHs

or RS-GBSs ) directly to the first strand cDNA synthesis reaction. Mix well and reseal the plate using a fresh foil and spin down.

Incubate for 10 minutes at 95 °C, then cool down to 25 °C. Spin down and carefully

remove the sealing foil. Proceed immediately to step 7. REMARK: Reduce the timing to 5 minutes at 95 °C for inputs ≤1 ng total RNA (see Appendix C, p.23).

12 LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 16

Second Strand Synthesis

During this step the library is converted to dsDNA. Second strand synthesis is initiated by a random primer containing an Illumina-compatible linker sequence at its 5’ end.

OPTIONAL: At step 7 the UMI Second Strand Synthesis Module for QuantSeq FWD (Illumina,

Read 1, Cat. No. 081) may be used to include Unique Molecular Identiﬁers (UMIs) in QuantSeq FWD libraries. The UMI Second Strand Synthesis Mix (USS ) replaces the Second Strand Synthesis Mix 1 (SS1 ) from the standard QuantSeq FWD Kit (Cat. No. 015) (see Appendix J, p.33).

ATTENTION: Important notes for Second Strand Synthesis.

• SS1 and USS are viscous solutions. Thaw at 37 °C and mix thoroughly before use. If a

precipitate is visible, incubate further at 37 °C, and mix until buﬀer components dissolve

completely.

is not compatible with QuantSeq REV Kits. Use only for QuantSeq FWD library pre-

• USS

paration.

NOTE: At this point we recommend placing the Puriﬁcation Module (PB, PS, and EB) for step 12 at

room temperature to give it at least 30 minutes to equilibrate.

Add 10 µl Second Strand Synthesis Mix 1 (SS1 ) or 10 µl UMI Second Strand Synthe-

sis Mix (USS

NOTE: Use a pipette set to 30 µl for eﬃcient mixing.

Incubate for 1 minute at 98 °C in a thermocycler, and slowly cool down to 25 °C at a

reduced ramp speed of 0.5 °C/second. Incubate the reaction for 30 minutes at 25 °C. Quickly spin down the plate before removing the sealing foil.

Prepare a mastermix containing 4 µl Second Strand Synthesis Mix 2 (SS2 ) and 1 µl

Enzyme Mix 2 (E2 ). Mix well. ATTENTION: Keep the mastermix at room temperature.

)

to the reaction. Mix well by pipetting, seal the plate, and spin down.

Add 5 µl of the SS2 / E2 mastermix per reaction. Mix well and spin down.

Incubate for 15 minutes at 25 °C, then brieﬂy spin down. Safe stopping point. Libraries

can be stored at -20 °C at this point.

13LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 17

Puriﬁcation

The double-stranded library is puriﬁed using magnetic beads to remove all reaction components. The Puriﬁcation Module (PB, PS, and EB) should equilibrate for 30 minutes at room temperature before use. The Puriﬁcation Beads (PB) must be fully resuspended before use. Thorough mixing by pipetting or vortexing is recommended.

ATTENTION: If the libraries were stored at -20 °C, ensure that they are thawed and equilibrated

to room temperature, and spun down before restarting the protocol.

Add 16 µl of Puriﬁcation Beads (PB) to each reaction. Mix well, and incubate for 5 min-

utes at room temperature.

Place the plate onto a magnet and let the beads collect for 2 - 5 minutes or until the super-

natant is completely clear.

Remove and discard the clear supernatant without removing the PCR plate from the

magnet. Make sure that accumulated beads are not disturbed.

Add 40 µl of Elution Buffer (EB), remove the plate from the magnet and resuspend the

beads fully in EB. Incubate for 2 minutes at room temperature.

Add 56 µl of Puriﬁcation Solution (PS) to the beads / EB mix to reprecipitate the library. Mix thoroughly and incubate for 5 minutes at room temperature. REMARK: For low

input / low quality / FFPE RNA, add only 48 µl PS (see Appendix C, p.23 and Appendix D, p.24).

Place the plate onto a magnet and let the beads collect for 2 - 5 minutes, or until the

supernatant is completely clear.

Remove and discard the clear supernatant without removing the plate from the mag-

net. Do not disturb the beads.

Add 120 µl of 80 % EtOH, and incubate for 30 seconds. Leave the plate in contact with

the magnet as beads should not be resuspended during this washing step. Remove and discard the supernatant.

Repeat this washing step once for a total of two washes. Remove the supernatant

completely, as traces of ethanol can inhibit subsequent PCR reactions.

Leave the plate in contact with the magnet, and let the beads dry for 5 - 10 minutes or until all ethanol has evaporated. ATTENTION: Dry the beads at room temperature

only and do not let the beads dry too long (visible cracks appear), this will negatively inﬂuence the elution and the resulting library yield.

Add 20 µl of Elution Buﬀer (EB) per well, remove the plate from the magnet and resus-

pend the beads fully in EB. Incubate for 2 minutes at room temperature.

Place the plate onto a magnet and let the beads collect for 2 - 5 minutes, or until the

supernatant is completely clear.

Transfer 17 µl of the clear supernatant into a fresh PCR plate. Do not transfer any beads.

Safe stopping point. Libraries can be stored at -20 °C at this point.

14 LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 18

5.2. Library Ampliﬁcation - Single Indexing (i7 only)

This section describes single indexing PCR (i7 indices only) for multiplexing and unique indexing of up to 96 libraries using the Lexogen i7 6 nt Index Set included in the kit. Lexogen also oﬀers i5 Dual Indexing Add-on Kits (Cat. No. 047), which enable dual indexing for up to 9,216 diﬀerent i5 / i7 index combinations, or preparation of 96 libraries with unique dual indexing. For details, please refer to the i5 Dual Indexing Add-on Kits Instruction Manual (047IM109).

NOTE: QuantSeq Library Prep Kits (FWD and REV) are compatible with Lexogen UDI 12 nt

Unique Dual Indexing Add-on Kits. For details, please refer to the Lexogen 12 nt Unique Dual Indexing Add-on Kits Instruction Manual (107IM223).

Preparation

PCR Purication

PCR – thawed at RT E3 – keep on ice or at -20 °C i7 6 nt Index Set – thawed at RT; spin down before opening!

Thermocycler 98 °C, 30 sec

98 °C, 10 sec 65 °C, 20 sec 72 °C, 30 sec

72 °C, 1 min 10 °C, ∞

12 - 26x

Appendix E, p.25

PB – stored at +4 °C PS – stored at +4 °C 80 % EtOH – provided by user; prepare fresh! EB – stored at +4 °C

Equilibrate all reagents to room temperature for 30 minutes prior to use.

PCR

The library is ampliﬁed to add the complete adapter sequences required for cluster generation and unique indices for multiplexing, and to generate suﬃcient material for quality control and sequencing.

ATTENTION: Important notes for Library Ampliﬁcation.

• Perform a qPCR assay to determine the optimal PCR cycle number for endpoint PCR.

The number of PCR cycles for library ampliﬁcation must be adjusted according to RNA input

amount, quality, and sample type. The PCR Add-on Kit for Illumina (Cat. No. 020) is required.

For qPCR assay details see Appendix E, p.25.

• Avoid cross contamination when using the Lexogen i7 6 nt Index Set. Spin down the Index

Set before opening and visually check ﬁll levels. Pierce or cut open the sealing foil of the

wells containing the desired indices only. Reseal opened wells after use to prevent cross

contamination.

• Each well of the Lexogen i7 6 nt Index Set is intended for single use only.

15LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 19

NOTE: At this point we recommend placing the Puriﬁcation Module (PB, PS, and EB) for step 29

at room temperature to give it at least 30 minutes to equilibrate.

OPTIONAL: For unique dual indexing with the Lexogen UDI 12 nt Unique Dual Indexing Add-

on Kits (Cat. No. 107-111, 120), please refer to the respective Instruction Manual (107IM223). Do not use PCR !

Prepare a mastermix containing 7 µl of PCR Mix (PCR ) and 1 µl Enzyme Mix 3 (E3 )

per reaction, mix well by pipetting, spin down.

Add 8 µl of the PCR / E3 mastermix to 17 µl of the eluted library.

Add 5 µl of the respective i7 index (7001-7096, in 96-well plate). Mix well by pipetting.

Seal the PCR plate and quickly spin down. ATTENTION: Reseal opened wells of the Lexogen i7 6 nt Index Set after use to prevent cross contamination.

Conduct 11 - 25 cycles of PCR (as determined by qPCR, see Appendix E, p.25) with: Initial denaturation at 98 °C for 30 seconds; 11 - 25 cycles of 98 °C for 10 seconds, 65 °C

for 20 seconds and 72 °C for 30 seconds, and a ﬁnal extension at 72 °C for 1 minute, hold at 10 °C. Safe stopping point. Libraries can be stored at -20 °C at this point.

Puriﬁcation

The ﬁnished library is puriﬁed from PCR components that can interfere with quantiﬁcation. The Puriﬁcation Module (PB, PS, and EB) should equilibrate for 30 minutes at room temperature before use. The Puriﬁcation Beads (PB) must be fully resuspended before use. Thorough mixing by pipetting or vortexing is recommended.

ATTENTION: If the libraries were stored at -20 °C, ensure that they are thawed and equilibrated

to room temperature, and spun down before restarting the protocol.

For QuantSeq (standard input >10 ng) libraries, add 30 µl of thoroughly resuspended Puriﬁcation Beads (PB) to each reaction. REMARK: For QuantSeq libraries gen-

erated from low input (≤10 ng) / low quality / FFPE RNA, add only 27 µl PB (see Appendix C, p.23 and Appendix D, p.24). Mix well, and incubate for 5 minutes at room temperature.

Place the plate onto a magnet and let the beads collect for 2 - 5 minutes or until the super-

natant is completely clear.

Remove and discard the clear supernatant without removing the PCR plate from the

magnet. Do not disturb the beads.

Add 30 µl of Elution Buﬀer (EB), remove the plate from the magnet, and resuspend the

beads fully in EB. Incubate for 2 minutes at room temperature.

16 LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 20

Add 30 µl of Puriﬁcation Solution (PS) to the beads / EB mix to reprecipitate the library.

Mix thoroughly and incubate for 5 minutes at room temperature.

Place the plate onto a magnet and let the beads collect for 2 - 5 minutes, or until the

supernatant is completely clear.

Remove and discard the clear supernatant without removing the plate from the mag-

net. Do not disturb the beads.

Add 120 µl of 80 % EtOH, and incubate the beads for 30 seconds. Leave the plate in

contact with the magnet as beads should not be resuspended during this washing step. Remove and discard the supernatant.

Repeat this washing step once for a total of two washes. Remove the supernatant

completely.

Leave the plate in contact with the magnet, and let the beads dry for 5 - 10 minutes or until all ethanol has evaporated. ATTENTION: Dry the beads at room temperature

only and do not let the beads dry too long (visible cracks appear), this will negatively inﬂuence the elution and the resulting library yield.

Add 20 µl of Elution Buﬀer (EB) per well, remove the plate from the magnet, and resus-

pend the beads fully in EB. Incubate for 2 minutes at room temperature.

Place the plate onto a magnet and let the beads collect for 2 - 5 minutes, or until the

supernatant is completely clear.

Transfer 15 - 17 µl of the supernatant into a fresh PCR plate. Do not transfer any beads. Libraries are now ﬁnished and ready for quality control (Appendix G, p.28), pooling

(for multiplexing, Appendix K, p.35), and cluster generation.

Safe stopping point. Libraries can be stored at -20 °C at this point.

17LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 21

6. Short Procedure

ATTENTION: Spin down before opening tubes or plates!

Standard Input Low Input (≤10 ng) / Low Quality / FFPE

First Strand cDNA Synthesis

Mix 5 µl RNA and 5 µl FS1 . Skip! Place RNA samples at room temp.

Incubate for 3 min at 85 °C, then cool to 42 °C.

Keep samples on thermocycler at 42 °C!

Prepare a mastermix with 9.5 µl FS2 and

0.5 µl E1 per reaction, mix well and prewarm for 2 - 3 min at 42 °C.

Add 10 µl FS2 / E1 mix per reaction, mix well.

Keep samples on thermocycler at 42 °C when adding mastermix!

Incubate for 15 min at 42 °C.

Proceed immediately to RNA Removal!

RNA Removal

Add 5 µl RS (or RS-GB ), mix well. Add 5 µl RS (or RS-GB ), mix well.

Incubate 10 min at 95 °C, cool to 25 °C. For ≤10 ng: Incubate 10 min at 95 °C; or

Second Strand Synthesis

Add 10 µl SS1 (or USS ), mix well.

Incubate 1 min at 98 °C, slowly ramp down to 25 °C (0.5 °C / sec).

Incubate 30 min at 25 °C.

Prepare a mastermix with 4 µl SS2 and 1 µl E2 per reaction, mix well.

Add 5 µl SS2 / E2 mix per reaction, mix well.

Incubate 15 min at 25 °C. Safe stopping point.

Purication

Add 16 µl PB per reaction, mix well, incubate 5 min at RT.

Place on magnet for 2 - 5 min, discard supernatant.

Add 40 µl EB, remove from magnet, mix well, incubate 2 min at RT.

Add 56 µl PS, mix well, incubate 5 min at RT. For low input / low quality / FFPE: Add 48 µl

Place on magnet for 2 - 5 min, discard supernatant.

Rinse beads twice with 120 µl 80 % EtOH, 30 sec.

Air dry beads for 5 - 10 min. ATTENTION: Do not let the beads dry too long!

Add 20 µl EB, remove from magnet, mix well, incubate 2 min at RT.

Place on magnet for 2 - 5 min, transfer 17 µl of the supernatant into a fresh PCR plate. Safe stopping point.

Skip!

Prepare a mastermix with 5 µl FS1 , 9.5 µl FS2 , and 0.5 µl E1 per reaction, mix well and pre-warm for 2 - 3 min at 42 °C.

Add 15 µl FS1 / FS2 / E1 mix per sample, mix well and spin down. Transfer samples

to thermocycler at 42 °C!

Incubate for 15 min (or 1 hr) at 42 °C. Proceed immediately to RNA Removal!

for ≤1 ng: Incubate 5 min at 95 °C; then cool to 25 °C.

PS, mix well, incubate 5 min at RT.

3.3 hrs

Library Generation

18 LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 22

ATTENTION: Spin down before opening tubes or plates!

1.2 hrs (+qPCR) Library Ampliﬁcation

Standard Input Low Input (≤10 ng) / Low Quality / FFPE

qPCR [Strongly Recommended! Requires PCR Add-on Kit (Cat. No. 020.96)]

Add 2 µl of EB to the 17 µl of eluted cDNA.

Prepare a 2.5x stock of SYBR Green I nucleic acid stain (i.e., 1:4,000 dilution in DMSO; use Sigma-Aldrich, Cat. No. S9430).

Combine 1.7 µl of cDNA with: 7 µl PCR , 5 µl Primer 7000, 1 µl E (from PCR Add-on Kit), 1.2 µl of

2.5x SYBR Green I nucleic acid stain, and 14.1 µl of EB, per reaction. Mix well.

PCR: 98 °C, 30 sec.

98 °C, 10 sec 65 °C, 20 sec 72 °C, 30 sec 72 °C, 1 min

10 °C, ∞. Calculate the optimal cycle number for Endpoint PCR (see Appendix E, p.25).

Endpoint PCR

Prepare a mastermix with 7 µl PCR and 1 µl E3 per reaction, mix well.

Add 8 µl PCR / E3 mastermix to 17 µl of each puriﬁed library.

Add 5 µl i7 Primer (7001-7096, from the 96-well plate) for each reaction, mix well.

ATTENTION: Reseal opened index wells after use!

PCR: 98 °C, 30 sec

98 °C, 10 sec 65 °C, 20 sec 72 °C, 30 sec 72 °C, 1 min

10 °C, ∞. Safe stopping point.

Purication

Add 30 µl PB per reaction, mix well, incubate 5 min at RT.

Place on magnet for 2 - 5 min, discard supernatant.

Add 30 µl EB, remove from magnet, mix well, incubate 2 min at RT.

Add 30 µl PS, mix well, incubate 5 min at RT.

Place on magnet for 2 - 5 min, discard supernatant.

Rinse the beads twice with 120 µl 80 % EtOH, 30 sec.

Air dry beads for 5 - 10 minutes. ATTENTION: Do not let the beads dry too long!

Add 20 µl EB, remove from magnet, mix well, incubate 2 min at RT.

Place on magnet for 2 - 5 min, transfer 15 - 17 µl of the supernatant into a fresh PCR plate.

Safe stopping point.

35x (see p.25)

11 - 25x (see p.25)

ATTENTION: Increased cycle numbers may be required

for low input / low quality / FFPE RNA (see Appendices C, p.23 and D, p.24)

For low input / low quality / FFPE: Add 27 µl PB per reaction, mix well, incubate 5 min at RT.

19LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 23

7. Appendix A: General RNA Requirements

RNA Purity and Chemical Contaminants

RNA samples should be free of salts, metal ions, and organic solvents, which can be carried over from RNA extraction. Several sources of contamination can be detected with a UV-Vis spectrophotometer. An acceptably pure RNA sample should have an A260/A280 ratio between 1.8 and

2.1. The A260/A230 ratio should be approximately 2. Several common contaminants including

proteins, chaotropic salts, and phenol absorb strongly between 220 and 230 nm and can often be identiﬁed as peaks in this region. Contamination with any of these generates a lower A260/230 ratio. Phenol has an additional absorption maximum between 250 and 280 nm, which overlaps that of nucleic acid, so high 230 nm absorbance combined with a biphasic or broad peak between 250 and 280 nm may indicate contamination with phenol rather than chaotropic salts. These contaminants may have a negative impact on the eﬃciency of the protocol.

Genomic DNA Contamination

Depending on the RNA extraction protocol used, samples may also contain signiﬁcant amounts of genomic DNA (gDNA), which is indistinguishable from RNA on a spectrophotometer. Furthermore, as many of the dyes used in RNA microﬂuidics assays stain single-stranded nucleic acids more intensively than double-stranded, low to moderate amounts of gDNA may not be readily visible with an RNA-speciﬁc microﬂuidics assay. We highly recommend examining all RNA samples on a denaturing agarose gel or using a ﬂuorometric assay with DNA- and RNA-speciﬁc dyes to check samples for DNA contamination. On an agarose gel gDNA can appear as either a dark mass, which remains in the slot if relatively intact, or as a high molecular weight smear if it has been sheared during extraction. QuantSeq libraries generated from samples containing gDNA may have an increased number of intergenic reads or lower strandedness. The best way to avoid gDNA contamination is to use an RNA extraction protocol that minimize gDNA content (e.g., Lexogen’s SPLIT RNA Extraction Kit, Cat. No. 008). However, DNA can be removed from irreplaceable samples by acidic phenol extraction or DNase I digestion. DNase I treatment is highly recommended for FFPE RNA. If samples must be DNase treated, heat inactivation should be avoided, and the enzyme should be deactivated by other means such as phenol / chloroform extraction or silica column puriﬁcation.

RNA Integrity

The integrity of an RNA sample can be assessed with a variety of methods. We recommend the use of a microﬂuidics assay such as the RNA6000 series for the 2100 Bioanalyzer (Agilent Technologies, Inc.), although RNA quality can also be assessed with denaturing agarose gel electrophoresis if such a device is not available. Most microﬂuidics platforms will carry out an automated peak analysis and generate a quality score (RIN or RQN). As QuantSeq speciﬁcally targets the 3’ end of transcripts even RNAs with a lower RIN are suitable as input material. The DV which measures the percentage of RNAs larger than 200 nt in the sample, is a better measure of quality for highly degraded RNA and FFPE RNA samples with very low RIN scores.

20 LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

value,

200

Page 24

Mitochondrial Ribosomal RNA

Mitochondrial ribosomal RNAs (mt-rRNAs) are polyadenylated and hence will also be reverse transcribed and converted into a cDNA library. mt-rRNAs can make up 1 - 2 % of the reads when using a 3’ mRNA-Seq protocol, such as QuantSeq, as only one fragment will be generated for each transcript. Optionally, an rRNA depletion method, which also removes mt-rRNAs, such as Lexogen’s RiboCop rRNA Depletion Kit (Cat. No. 037), can be used before starting the QuantSeq library preparation if it is essential to remove mt-rRNA transcripts.

RNA Storage

If immediate RNA extraction is not possible, tissue samples can be either ﬂash-frozen with liquid nitrogen or submerged in RNAlater (Life Technologies, Inc.) and stored at -80 °C. After extraction, RNA can be stored at -20 °C or -80 °C in 10 mM Tris pH 7.0. Addition of RNasin or an equivalent RNase inhibitor is recommended. Avoid frequent freeze / thaw cycles as RNA might be sheared.

SIRV™ Spike-in RNA Variant Control Mixes

The Lexogen SIRV™ (Spike-In RNA Variant) controls are artiﬁcial spike in transcripts that serve as a control and anchor set for the comparison of RNA-Seq experiments. The SIRVs consist of 69 artiﬁcial RNA transcripts with no identity to any known genomic sequences, hence they can be spiked into any RNA. SIRVs are available in three sets, SIRV-Set 1 (Cat. No 025) contains the Isoform Mixes E0, E1, and E2 of the isoform module, SIRV-Set 2 (Cat. No. 050) provides the Isoform Mix E0 only, whereas SIRV-Set 3 (Cat. No. 051) has the SIRV Isoform Mix E0 in a mixture with the ERCC RNA Spike-in controls (Thermo Fisher Scientiﬁc Inc., see below). The SIRVs are polyadenylated mRNAs and therefore are eﬃciently captured during QuantSeq 3’ library preparation.

ERCC RNA Spike-in Controls

To enable the hypothesis-neutral calculation of strandedness, to assess internal oligodT priming events, and as a true reference on detection limit and preservation of dynamic range, we highly recommend the addition of artiﬁcial transcripts of known strand orientation and concentration such as the ERCC RNA Spike-in controls (Thermo Fisher Scientiﬁc Inc.). For QuantSeq we recommend using SIRV-Set 3 (Cat. No. 051), which contains ERCCs together with the SIRV isoform controls. ERCCs have a known strand orientation and no antisense transcripts, so the calculation of strandedness based on ERCC sequences is more accurate than calculations based on reads aligned to the genome. The input-output correlation can be computed by comparing the given concentrations of the ERCC RNA Spike-in transcripts with their expression value in the sequenced library. Any potential overcycling of the libraries can be detected. Transcripts may have diﬀerent and not yet annotated 3’ ends, which might be mistaken for internal priming events of the oligodT primer, when in fact those are true 3’ ends. As ERCC transcripts only have one deﬁned 3’ end, this provides the only true measure to determine internal priming.

21LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 25

8. Appendix B: RNA Input and PCR Cycles

Total RNA is the intended input for QuantSeq FWD and REV library preparation. No prior rRNA depletion or poly(A) enrichment is required. As QuantSeq is a 3’ mRNA-Seq protocol both high and low quality RNA can be used as input. Any total RNA sample that contains polyadenylated mRNA can be used, including e.g., bacterial RNA samples that have been previously polyadenylated. QuantSeq has been tested extensively using high quality Universal Human Reference RNA (UHRR) across a wide range of input amounts (100 pg - 500 ng). When using input amounts ≤1 ng of total RNA, PCR cycle optimization is required and we strongly recommend including a no-input control.

Input Guidelines

• We recommend performing the protocol initially with 500 ng total RNA. RNA inputs ≥200 ng

are recommended to detect low abundant transcripts eﬃciently.

• The minimum recommended input amounts of high-quality total RNA are 100 pg for Quant-

Seq FWD Library Prep, and 10 ng for QuantSeq REV.

• The minimum recommended input for QuantSeq FWD libraries prepared from whole blood

total RNA, using the Globin Block Modules (RS-GB) is 50 ng. For lower input amounts, mapping rates and gene detection may be reduced.

• The maximum recommended input is 500 ng.

• Lower RNA inputs (≤10 ng), and low quality RNA samples (including FFPE) require protocol

modiﬁcations, including adjusting the number of PCR cycles for the endpoint PCR (see Appendix D, p.24 and Appendix E, p.25).

• The optimal cycle number for your specic sample type should be determined using

the qPCR assay (see Appendix E, p.25). Libraries prepared from blood total RNA with globin block, typically require one cycle more than libraries prepared from blood total RNA without globin block.

• The number of PCR cycles optimal for a given input amount of total RNA can vary by up to

four and should be determined for diﬀerent sample types using the qPCR assay. The table below is provided as a reference only! Optimal cycle numbers could exceed these ranges depending on the sample type (e.g., species, tissue, RNA quality (e.g., FFPE RNA)).

Total RNA Input

Amount

0.5 ng* 21 - 25

10 ng* 17 - 20

100 ng 14 - 17

≥500 ng 11 - 14

* Using low input protocol modiﬁcations with 1 hour incubation at 42 °C at step 4 (See Appendix C, p.23). ** These values are provided as a reference only! Sample type inﬂuences the optimal cycle number, which should be determined by qPCR assay (See Appendix E, p.25).

22 LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

No. Cycles for

Endpoint PCR**

Page 26

9. Appendix C: Low Input RNA

When working with low input RNA (≤10 ng), low quality or degraded RNA, or RNA isolated from Formalin-Fixed Paraﬃn Embedded (FFPE) samples, only minor protocol modiﬁcations are recommended in order to maximise the consistency and yield of the libraries. Diﬀerent protocol modiﬁcations apply when using input amounts ≤10 ng, or ≤1 ng, or when using FFPE RNA (see also Appendix D, p.24). These are outlined in the table below alongside the standard protocol steps.

Protocol

Step

Add FS1 to RNA samples. Do not place

Step

* Only for QuantSeq FWD. Minimum input for QuantSeq REV is 10 ng.

samples back on ice after adding FS1 !

Incubate for 3 minutes at 85 °C, then cool

to 42 °C. Hold samples at 42 °C on the thermocycler.

Prepare FS2 / E1 mastermix – pre-warm for

2 - 3 minutes at 42 °C.

Add pre-warmed mastermix to RNA / FS1

samples on the thermocycler at 42 °C. Incubate for 15 minutes at 42 °C.

Incubate for 10 minutes at 95 °C.

Add 56 l of Puriﬁcation Solution (PS). Reduce volume of Puriﬁcation Solution (PS) to 48 l.

The qPCR assay is strongly recommended for optimizing the number of PCR cycles required for library ampliﬁcation. This will prevent under- or overcycling of the libraries (see Appendix E, p.25): The qPCR assay should be performed also when RNA samples are of:

• Variable input amount

• Variable quality (RIN / RQN) or purity (absorbance ratios: 260/280 and 260/230)

• Variable type (e.g., species, tissue, cell type)

• FFPE origin, or highly degraded

Add 30 l of Puriﬁcation Beads (PB) for

single-indexed libraries, or 35 l for dual-indexed libraries.

Standard Input

(>10 ng)

Skip denaturation step! Place RNA samples brieﬂy at

room temperature while the mastermix is prepared.

Prepare FS1 / FS2 / E1 mastermix – pre-warm for 2 - 3 minutes at 42 °C.

Add pre-warmed mastermix to RNA samples at room temperature and transfer to a thermocycler preheated to 42 °C. Incubate for 15 minutes at 42 °C, or increase incubation time to 1 hour.

Incubate for 10 minutes at 95 °C.

Reduce volume of Puriﬁcation Beads (PB) to 27 l for single-indexed libraries, or 31.5 l for dual-indexed libraries.

Low Input (≤10 ng)*

FFPE / Degraded RNA

Low Input (≤1 ng)*

Incubate for 5 minutes at 95 °C.

23LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 27

10. Appendix D: Low Quality RNA - FFPE

RNA isolated from Formalin-Fixed Paraﬃn Embedded (FFPE) samples is often heavily degraded. As QuantSeq is a 3’ mRNA-Seq protocol it is highly suitable for FFPE RNA. For FFPE samples only minor protocol adjustments are required (see also Appendix C, p.23), speciﬁcally:

• Skipping steps 1 and 2 and preparing a mastermix of FS1 / FS2 / E1.

• Reducing the volume of PS in step 16 to 48 µl.

• Reducing the volume of PB in step 29 to 27 µl for single indexing PCR, and 31.5 µl in step

for dual indexing PCR, respectively (see FAQs at www.lexogen.com).

Further optional adjustments for low input FFPE RNA samples may also be included, such as:

• Extending the reverse transcription time in step 4 to 1 hour (≤10 ng).

• Reducing the RNA removal time in step 6 to 5 minutes at 95 °C (≤1 ng).

As the RNA amount is often a limiting factor with FFPE samples, QuantSeq was tested with 500 pg - 50 ng FFPE or degraded RNA input, including mouse (Mm) brain FFPE RNA input with a RIN of 1.8 (DV otides. The lower the DV

ATTENTION:

• FFPE RNA samples are highly variable. Samples with lower mRNA content, or lower DV

values may require more PCR cycles. We strongly recommend performing a qPCR assay

(using Lexogen’s PCR Add-on Kit for Illumina (Cat. No. 020), Appendix E, p.25) to determine

the optimal cycle number for library ampliﬁcation.

• FFPE RNA is highly degraded, hence the insert sizes are smaller than for non-degraded RNA

samples (see also Appendix G, p.28). Keep this in mind when choosing your sequencing

length.

• If you see that your FFPE RNA generates ~150 bp linker-linker products despite the above-

mentioned protocol changes, re-puriﬁcation of the lane mix with 0.9x PB (e.g., 50 µl lane mix

plus 45 µl of PB, incubating 5 minutes at room temperature, and following the protocol from

step 30 on again) may be necessary.

• FFPE RNA can be contaminated with fragmented DNA, which may result in an overestima-

tion of inserted RNA and/or in a high number intronic and intergenic reads in NGS samples.

For FFPE RNA it may be advisable to perform a DNase I treatment, or to distinguish between

RNA and DNA when quantifying your input material. Heat inactivation of DNase I should be

avoided, and the enzyme should be deactivated by other means such as phenol / chloroform

extraction or silica column puriﬁcation.

• Optional: Add SIRV-Set 3 (0.1 - 0.2 % of target RNA fraction) prior to DNase I treatment.

For further questions, please contact support@lexogen.com.

of 51 %). The DV

200

, the more degraded the RNA is.

200

is the percentage of RNA fragments larger than 200 nucle-

200

24 LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 28

11. Appendix E: qPCR

Adjusting PCR Cycle Numbers for Sample Type

The mRNA content and quality of total RNA aﬀects the number of PCR cycles needed for the ﬁnal library ampliﬁcation step. Variable input types and amounts require optimization of PCR cycle numbers (see Appendix B, p.22). We strongly recommend taking advantage of the qPCR assay to optimize the number of cycles required for the endpoint PCR. This will pre- vent both under and overcycling, the latter of which may bias your sequencing results (see also Appendix G, p.28).

The mRNA content of RNA samples can vary between species and tissue / cell types. Variable RNA quality, particularly for FFPE RNA samples may also aﬀect diﬀerences in mRNA content between samples.

The PCR Add-on Kit for Illumina (Cat. No. 020) is required for the following qPCR assay protocol. This assay can be used to determine cycle numbers for subsequent dual or single indexing PCRs.

qPCR to Determine the Optimal Cycle Number for Endpoint PCR

The PCR Add-on Kit provides additional PCR Mix (PCR ), Enzyme Mix (E ), and the P7 Primer (7000 ) required for the qPCR assay. In addition, SYBR Green I nucleic acid dye (Sigma Aldrich, S9430 or ThermoFisher, Cat. No. S7585) is also needed and must be supplied by the user. Enzyme Mix 3 (E3 ) supplied in the QuantSeq Kits, and E from the PCR Add-on Kit can be used interchangeably. PCR is also interchangeable between the PCR Add-on and QuantSeq Kits.

ATTENTION: The use of SYBR Green I-containing qPCR mastermixes from other vendors is not

recommended.

NOTE: SYBR Green I has an emission maximum at 520 nm, which for some qPCR machines has

to be adjusted manually.

Dilute the double-stranded library from step 24 to 19 µl by adding 2 µl Elution Buﬀer

(EB) or molecular biology-grade water.

Prepare a 1:4,000 dilution of SYBR Green I dye in DMSO, for a 2.5x working stock con-

centration. ATTENTION: The ﬁnal concentration in the reaction should be 0.1x. Higher concentrations of SYBR Green I will inhibit ampliﬁcation.

For each reaction combine: 1.7 µl of the diluted cDNA library, 7 µl of PCR Mix (PCR ), 5 µl of P7 Primer (7000 ), 1 µl of Enzyme Mix (E ), and 1.2 µl of 2.5x SYBR Green I nucle-

ic acid dye. Make the total reaction volume up to 30 µl by adding 14.1 µl of Elution Buﬀer (EB) or molecular biology-grade water. ATTENTION: Include a no template control!

25LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 29

Perform 35 cycles of PCR with the following program: Initial denaturation at 98 °C for 30 seconds, 35 cycles of 98 °C for 10 seconds, 65 °C for 20 seconds and 72 °C for

30 seconds, and a ﬁnal extension at 72 °C for 1 minute, hold at 10 °C REMARK: There is no need to purify or analyze the overcycled PCR reaction on a Bioanalyzer.

Using the ampliﬁcation curves in linear scale, determine the value at which the ﬂuorescence reaches the plateau. Calculate 50 % of this maximum ﬂuorescence value and determine at which cycle this value is reached. As the endpoint PCR will contain 10x

more cDNA compared to the qPCR, subtract three from this cycle number. This is then the ﬁnal cycle number you should use for the endpoint PCR with the remaining 17 µl of the template (see Fig. 3).

Endpoint PCR Cycle Calculation

When using 1.7 µl of cDNA for a qPCR, if the cycle number corresponding to 50 % of the maximum ﬂuorescence is 15 cycles, the remaining 17 µl of the template should therefore be ampliﬁed with 12 cycles (15 - 3 cycles =12 cycles, Fig. 3).

Figure 3. Calculation of the number of cycles for the endpoint PCR.

NOTE: Once the number of cycles for the endpoint PCR is established for one type of sample

(same input amount, tissue / cell type, and RNA quality), there is no need for further qPCRs. The entire cDNA can be inserted straight into the endpoint PCRs.

26 LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 30

12. Appendix F: Library Reampliﬁcation

Reampliﬁcation of Single-Indexed Libraries (i7 only)

Lexogen’s PCR Add-on Kit also contains a i7 Reampliﬁcation Primer (i7-RE ) that can be used to that can be used to

reamplify single-indexed (i7) libraries to get enough material for sequencing reamplify single-indexed (i7) libraries to get enough material for sequencing if they were under-if they were under- cycledcycled. For details please refer to the PCR Add-on Kit (Cat. No. 020) Instruction Manual.. For details please refer to the PCR Add-on Kit (Cat. No. 020) Instruction Manual.

Reampliﬁcation of Dual-Indexed Libraries (i5 and i7)

For reampliﬁcation of dual-indexed libraries the Reampliﬁcation Add-on Kit for Illumina (Cat. No.

080.96) is available on request. Please contact Lexogen at support@lexogen.com.

27LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 31

13. Appendix G: Library Quality Control

Quality control of ﬁnished QuantSeq libraries is highly recommended and should be carried out prior to pooling and sequencing. A thorough quality control procedure should include the analysis of library concentration and size distribution (i.e., library shape).

Quality Control Methods

The analysis of a small volume of the ampliﬁed library with microcapillary electrophoresis has become standard practice for many NGS laboratories and generates information regarding library concentration and size distribution. Several electrophoresis platforms are available from various manufacturers. For low- to medium-throughput applications, we recommend the Bioanalyzer 2100 and High Sensitivity DNA chips (Agilent Technologies, Inc.). For high throughput applications instruments such as the Fragment Analyzer or 2200 TapeStation (Agilent Technologies, Inc.), or LabChip GX II (Perkin Elmer) are recommended. Typically, 1 µl of a QuantSeq library produced according to the directions in this manual is suﬃcient for analysis. Depending on the minimum sample loading requirements for each instrument, 1 µl of the ﬁnished library may be diluted to the required volume (e.g., 2 µl sample for TapeStation and 10 µl for LabChip GX II).

More accurate library quantiﬁcation can be achieved with custom or commercially available qPCR assays. With these assays, the relative or absolute abundance of ampliﬁable fragments contained in a ﬁnished QuantSeq library is calculated by comparing Cq values to a set of known standards. While delivering a more accurate quantiﬁcation, these assays do not supply the user with information regarding library size distribution. Unwanted side-products such as linker-linker artifacts are not discernible from the actual library in the qPCR assay as both will be ampliﬁed. Hence it is highly recommended to combine such an assay for quantiﬁcation with microcapillary electrophoresis analysis for library size distribution.

If microcapillary electrophoresis platforms and qPCR machines are not available, very basic quality control can also be performed by separating a small aliquot of the library on a polyacrylamide or agarose gel. Library quantiﬁcation can also be performed with an inexpensive benchtop ﬂuorometer using one of several commercially available assays, e.g., Qubit dsDNA HS assay. Most UVVis spectrophotometers (e.g., NanoDrop, Thermo Fisher Scientiﬁc Inc.), are not sensitive enough to accurately quantify NGS libraries at these concentrations and should be avoided.

Typical Results

QuantSeq libraries are intended for a high degree of multiplexing, and hence libraries do not need to be extensively ampliﬁed. Library yield, shape, and average insert size may vary depending on the type of input sample (e.g., FFPE samples typically produce shorter libraries than high quality Universal Human Reference RNA (UHRR), see Figures 4 and 5). The majority of inserts are greater than 75 bp in size, corresponding to ﬁnal library fragment sizes ≥200 bp.

28 LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 32

[FU]

[

150

100

35 100 200 300 400 500 700 2000 10 380 [bp]

[bp] ladder 500 ng

12 cycles

10 ng

18 cycles

500 pg

22 cycles

Figure 4. Bioanalyzer traces of QuantSeq FWD libraries prepared from dierent input amounts of total RNA input (UHRR). Libraries were prepared with the standard protocol, using 500 ng (red trace, 12 PCR cycles). Libraries with 10 ng (blue trace, 18 PCR cycles) and 500 pg (green trace, 22 PCR cycles) of UHRR input were prepared using low input protocol modiﬁcations (see Appendix C, p.23; reverse transcription for 1 hour at 42 °C for both, 5 minute incubation at 95 °C for 500 pg). Endpoint PCR was performed using the non-indexed P7 Primer 7000 (from the PCR Add-on Kit, Cat. No. 020).

FU]

35 100 150 200 300 400 500 600 1000 2000 10380 [bp]

[bp] ladder 50 ng

FFPE RNA 15 cycles

10 ng FFPE RNA 18 cycles

500 pg

FFPE RNA

22 cycles

Figure 5. Bioanalyzer traces of QuantSeq FWD libraries synthesized from 50 ng (red trace), 10 ng (dark blue trace), and 500 pg (green trace), using mouse (Mm) brain FFPE RNA (RIN 1.8, DV were prepared with the recommendations for FFPE RNA input (Appendix D, p.24). 500 pg FFPE RNA libraries

51 %) as input. All libraries

200

already contain some artifacts below 150 bp which should be removed before sequencing, e.g., by repurifying the lane mix (see Appendix K, p.35).

Overcycling

A second peak in high molecular weight regions (between 1,000 - 9,000 bp) is an indication of overcycling. This could occur if cycle numbers are increased too much to compensate for lower input material. Prevent overcycling by using the qPCR assay as described in Appendix E, p.25.

29LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 33

14. Appendix H: Modulating Insert Sizes

100

150

200

[FU]

35 100 200 300 40 0 500 700 2000 103 80 [bp]

The QuantSeq-Flex First Strand Synthesis Module (Cat. No. 026) can be used to increase insert sizes for QuantSeq FWD libraries.

In short: FS1 and FS2 from the basic QuantSeq FWD kit are exchanged with FS1x , FS2x , and OligodT Primer(dT ) from the QuantSeq-Flex First Strand Synthesis Module (Cat. No. 026). Longer inserts can be generated when RNA is denatured only with dT for 3 minutes at 85 °C. Longer library sizes may be beneﬁcial for longer single-read sequencing, where increased length is beneﬁcial for enhanced mapping rates.

For further protocol details, please see the QuantSeq-Flex Targeted RNA-Seq Library Prep Kit V2 User Guide (015UG058).

[bp] ladder 500 ng

std.

13 cycles

500 ng RNA+dT 13 cycles

Figure 6. Bioanalyzer traces of QuantSeq FWD and Flex libraries prepared from 500 ng UHRR input RNA. Input RNA was denatured for 3 minutes at 85 °C, with either 5 μl oligodT from the QuantSeq-Flex First Strand Synthesis Module (Cat. No. 026; blue trace, RNA+dT), or the standard QuantSeq FWD FS1 buer (red trace, std.). Average library size is increased when RNA+dT conditions are used. Libraries were ampliﬁed with i7 and i5 6 nt index primers, using Dual PCR Mix (Lexogen i5 6 nt Dual Indexing Add-on Kit, Cat. No. 047) and 13 PCR cycles.

30 LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 34

15. Appendix I: Globin Block Modules

Mammalian blood contains an abundance of globin mRNAs, which are transcribed primarily from the haemoglobin alpha and beta globin chain genes (HBA1, HBA2, and HBB). Lexogen’s Globin Block Modules can be used with the FWD and REV QuantSeq Kits, to block the generation of library fragments from these abundant and highly stable globin mRNAs.

The Modules facilitate the depletion of globin mRNAs from blood total RNA. No prior globin depletion, poly(A) enrichment, or ribosomal RNA depletion is required. Each module consists of a modiﬁed RNA Removal Solution (RS-Globin Block, RS-GB ), containing species-speciﬁc Globin Blocker oligos. The RS-Globin Block Solutions (RS-GB ) simply replace the standard RNA Removal Solution (RS ) at the RNA Removal step of the standard QuantSeq 3’ mRNA-Seq Library Prep protocol.

The Globin Blocker oligos anneal to the 3’ ends of globin ﬁrst strand cDNA downstream of the random primers, and thereby prevent the generation of ampliﬁable library fragments from globin mRNAs during second strand synthesis (Fig. 7).

Random Priming

Second Strand

Synthesis

Figure 7. Globin Block Module for QuantSeq workﬂow.

Kit Components and Storage Conditions

5’

3’

Globin Blocker

5’

Reagent Box

(-20 oC)

RS-GB

Figure 8. Location of kit components.

Kit Component Tube Label

Removal Solution-Globin Block, Homo sapiens, 96 rxn (Cat. No. 070) RS-GBHs 528 µl -20 °C

Removal Solution-Globin Block, Sus scrofa, 96 rxn (Cat. No. 071) RS-GBSs 528 µl -20 °C

Volume*

96 rxn

*including ≥10 % surplus

Storage

NOTE: RS-Globin Block, Homo sapiens (RS-GBHs ) should be used for human blood RNA librar-

ies. RS-Globin Block, Sus scrofa (RS-GBSs ) should be used for pig blood RNA libraries. These Modules are designed to be species-speciﬁc. If you are interested in Globin Block for other species please contact us at support@lexogen.com.

31LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 35

Preparation

RNA Removal

RS-GBHs

or – thawed at RT

RS-GBSs

95 °C, 10 min cool down to 25 °C

Short Protocol: RNA Removal Globin Block

Removal Solution-Globin Block (RS-GB ) is added at step 5 of the QuantSeq protocol and replaces the RNA Removal Solution (RS ) from the standard QuantSeq 3’ mRNA-Seq Library Prep Kits (FWD: Cat. No. 015, REV: Cat. No. 016).

Follow steps 1 to 4 of the detailed protocol (p.11-12).

Add 5 µl of Removal Solution-Globin Block (RS-GBHs or RS-GBSs ), directly to the

first strand cDNA synthesis reaction. Mix well and reseal the plate using a fresh foil and spin down. REMARK: Use a pipette set to 15 µl for efficient mixing.

Incubate 10 minutes at 95 °C, then cool down to 25 °C. Spin down the plate at room

temperature and carefully remove the sealing foil.

Proceed with steps 7 to 41 of the detailed protocol (p.13-17)

RNA Input and Library Ampliﬁcation

The minimum recommended input for QuantSeq using Globin Block Modules is 50 ng of total RNA from whole blood, or leukocyte-enriched blood (i.e., after red blood cell lysis). Blood RNA samples may be highly variable depending on the origin and quality. The qPCR assay should be performed to determine the optimal number of cycles for library ampliﬁcation (see Appendix E, p.25).

Typical Results

Example results of QuantSeq Libraries, prepared from blood RNA using the QuantSeq 3’ mRNA-Seq Library Prep Kit (FWD) and RS-Globin Block Modules are available from the online Frequently Asked Questions (FAQs) for QuantSeq FWD (Globin Block Speciﬁc: https://www.

lexogen.com/quantseq-3mrna-sequencing/#quantseqfaq).

32 LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 36

16. Appendix J: Unique Molecular Identiﬁers

Unique Molecular Identiﬁers (UMIs) can be included in QuantSeq FWD libraries to enable the detection and removal of PCR duplicates. The UMI Second Strand Synthesis Module for QuantSeq FWD (Illumina, Read 1) (Cat. No. 081) includes the UMI Second Strand Synthesis Mix (USS ), which contains UMI-tagged random primers. The USS simply replaces the Second Strand Synthesis Mix 1 (SS1 ) from the standard QuantSeq FWD Kit. No other protocol changes are required. The UMIs are added between the partial P5 adapter and the random priming sequence, during second strand synthesis (Fig. 9).

5’

Second Strand

Synthesis

Figure 9. UMIs (red) are added during the second strand synthesis step of the QuantSeq workﬂow.

Random priming

3’

Kit Components and Storage Conditions

Reagent Box (-20 °C)

USS

Figure 10. Location of kit component.

UMI

3’

5’

Kit Component Tube Label

UMI Second Strand Synthesis Mix

(Cat. No. 081)

USS 1,056 µl -20 °C

Volume*

96 rxn

Storage

*including 10 % surplus

ATTENTION: Important notes for UMI Second Strand Synthesis Module use.

• The UMI Second Strand Synthesis Module for QuantSeq FWD (Illumina, Read 1) is not a

stand-alone kit and must be used in combination with the QuantSeq FWD Kit for Illumina (Cat. No. 015).

• The UMI Module is not compatible with QuantSeq REV (Cat. No. 016), or the QuantSeq

3’ mRNA-Seq Library Prep Kit for Ion Torrent (Cat. No. 012).

• The UMI Second Strand Synthesis Mix (USS ) replaces the Second Strand Synthesis Mix 1

(SS1 ) from the standard QuantSeq FWD Kit.

• The UMI Module can also be used for libraries prepared with Lexogen‘s Globin Block Modules

for QuantSeq (Cat. No. 070, 071), and are compatible with dual indexing using the Lexogen i5 6 nt Dual Indexing Add-on Kits (5001-5096) (Cat. No. 047) and Lexogen UDI 12 nt Unique Dual Index Sets (Cat. No. 107 - 111 and 120).

33LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 37

Preparation

Second Strand Synthesis

USS – thawed at 37 °C SS2 – thawed at RT E2 – keep on ice or at -20 °C

98 °C, 1 min, then cool to 25 °C (0.5 °C/sec) 25 °C, 30 min; 25 °C, 15 min

Short Protocol - Second Strand Synthesis

NOTE: This protocol replaces steps 7 and 8 of the detailed protocol (p.13). Step 8 has not

been changed for UMI libraries and is included here for ease of reference.

Follow steps 1 - 6 as indicated in the detailed protocol (p.11-13).

Add 10 µl of UMI Second Strand Synthesis Mix (USS ) to the reaction. Mix well by

pipetting, seal the plate and spin down. REMARK: Use a pipette set to 30 µl for eﬃcient mixing.

Incubate the plate for 1 minute at 98 °C in a thermocycler, and slowly cool down to 25 °C at a reduced ramp speed of 0.5 °C/second. Incubate the reaction for

30 minutes at 25 °C. Quickly spin down the plate at room temperature before removing the sealing foil.

Proceed to step 9 of the detailed protocol (p.13).

Sequencing

A minimum length of 75 bp (i.e., SR75 or longer) is recommended for sequencing QuantSeq FWD libraries that include UMIs. The 6 nt UMI is read-out at the beginning of Read 1, upstream of the random priming sequence (see below). No custom sequencing primers are required.

We recommend adding a minimum of 5 - 15 % PhiX spike-in when sequencing QuantSeq FWDUMI libraries in a pure lane-mix. For more information, please check the UMI Speciﬁc online FAQs at www.lexogen.com/quantseq-3mrna-sequencing/#quantseqfaq). Instructions for UMI data analysis are provided in Appendix M, p.42.

5’-(Read 1 Sequencing Primer)-3’ UMI

5’AATGATACGGCGACCACCGAGATCT-i5-ACACTCTTTCCCTACACGACGCTCTTCCGATCT- NNNNNN -(Insert…

3’TTACTATGCCGCTGGTGGCTCTAGA-i5-TGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA- NNNNNN -(Insert…

5’-(Index 1 (i7) Sequencing Primer)-3’

…Insert)-AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-i7-ATCTCGTATGCCGTCTTCTGCTTG 3’

…Insert)-TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG-i7-TAGAGCATACGGCAGAAGACGAAC 5’

3’-(Read 2 Sequencing Primer)-5’

Note: Some nucleotide sequences shown in Appendix J may be copyrighted by Illumina, Inc.

34 LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 38

17. Appendix K: Multiplexing

QuantSeq libraries are designed for a high degree of multiplexing. The i7 indices represent the minimum requirement for multiplexed sequencing and are added during the PCR ampliﬁcation. The i7 index primers are provided in 96-well plate format in all QuantSeq Library Prep Kits (Cat. No. 015, 016).

Single Indexing - i7 Indices

i7 indices allowing up to 96 samples to be sequenced per lane on an Illumina ﬂow cell are included in the kit (Lexogen i7 6 nt Index Set, 96-well plate). i7 indices are 6 nt long and require an additional index-speciﬁc sequencing reaction (Index 1 Read).

1 2 3 4 5 6 7 8 9 10 11 12

7001:

7009:

7017:

7025:

7033:

7041:

7049:

7057:

7065:

7073:

7081:

CAGCGT

7002: GATCAC

7003: ACCAGT

7004: TGCACG

7005: AC ATTA

7006: GTGTAG

7007: CTA GTC

7008: TGTGCA

TCAGGA

7010: CGGTTA

7011: T TAAC T

7012: ATGAAC

7013: CC TAAG

7014: AATCCG

7015: GGCTGC

7016: TAC CT T

TC TTA A

7018: GTCAGG

7019: ATAC TG

7020: TATGTC

7021: GAGTCC

7022: GGAGGT

7023: CACACT

7024: CCGCAA

TTTATG

7026: AACGCC

7027: CAAGCA

7028: GCTCGA

7029: GCGAAT

7030: TGGATT

7031: ACCTAC

7032: CGAAGG

AGATAG

7034: TTGGTA

7035: GT TACC

7036: CGCAAC

7037: TGGCGA

7038: ACCGTG

7039: CAACAG

7040: GATTGT

CTC TCG

7042: TGACAC

7043: AAGACA

7044: ACAGAT

7045: TAGGCT

7046: CT CCAT

7047: GCATGG

7048: AATAGC

GTGCCA

7050: TCGAGG

7051: CACTAA

7052: GG TATA

7053: CGCCTG

7054: AATGAA

7055: ACAACG

7056: ATATCC

AGTACT

7058: ATAAGA

7059: GGTGAG

7060: TTCCGC

7061: GAAGTG

7062: CAATGC

7063: ACGTC T

7064: CAGGAC

AAGCTC

7066: GACGAT

7067: TCGTTC

7068: CCAATT

7069: AGTTGA

7070: AACCGA

7071: CAGATG

7072: GTAGAA

GACATC

7074: CG ATCT

7075: CGTCGC

7076: ATGGCG

7077: ATTGGT

7078: GCCACA

7079: CAT CTA

7080: AACAAG

GCAGCC

7082: ACTCTT

7083: TG CTAT

7084: AAGTGG

7085: CT CATA

7086: CCGACC

7087: GGCCAA

7088: AGACCA

7089:

CGCGGA

7090:

CCTGCT

7091:

GCGCTG

7092:

GAACCT

7093:

TTCGA G

7094:

AGAATC

7095:

AGGCAT

7096:

ACACGC

The Lexogen i7 6 nt index sequences are available for download at www.lexogen.com.

In general, we recommend processing a minimum of 8 samples, using a complete set of eight i7 indices for multiplexing (e.g., 7001-7008). However, if fewer indices are required care should be taken to select indices that give a well-balanced signal in both lasers (red and green channels) for each nucleotide position. All columns (1 - 12) and rows (A - H) fulﬁll these criteria when individual libraries are mixed in an equimolar ratio. Use the online Index Balance Checker tool available at

https://www.lexogen.com/support-tools/index-balance-checker/, to select the ideal combina-

tion of indices for optimal color and nucleotide balance.

REMARK: If an 8 nt i7 index (Index 1) needs to be entered into an Illumina sample sheet, add

two nucleotides from the Illumina adapter sequence to the 3’ end of the index. EXAMPLE: 7001 would become CAGCGTAT, 7002 would become GATCACAT and so on. These additional nucleotides are identical for all indices as they are derived from the Illumina adapter.

35LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 39

Dual Indexing - i5 and i7 Indices

Two Lexogen i5 6 nt Dual Indexing Add-on Kits are available that enable dual indexing of QuantSeq libraries, for enhanced multiplexing capacity and improved control of index identiﬁcation accuracy.

The Lexogen i5 6 nt Unique Dual Indexing Add-on Kit (5001–5096) provides a 96-well plate containing 96 unique i5 indices (Cat. No. 047.96). This kit is designed for unique dual indexing in combination with Lexogen’s 96 i7 indices (included in all QuantSeq FWD and REV Library Prep Kits). Up to 96 uniquely dual-indexed libraries can be prepared for sequencing in a single lane or run. Alternatively, used together with the 96 i7 indices, up to 9,216 dual-indexed libraries with diﬀerent i5 / i7 index combinations can be multiplexed in a single sequencing lane or run.

The Lexogen i5 6 nt Dual Indexing Add-on Kit (5001–5004, Cat. No. 047.4) provides four diﬀerent i5 index primers (5001–5004). Each tube contains suﬃcient volume for preparing 24 libraries (Cat. No. 047.4x24). In combination with 96 i7 indices, a maximum of 384 (4 i5 x 96 i7) dual-indexed libraries with diﬀerent i5 / i7 index combinations can be multiplexed in a single sequencing lane or run.

Dual Indexing - Lexogen 12 nt Unique Dual Indexing Add-on Kits

QuantSeq Library Prep Kits (FWD and REV) are compatible with UDI 12 nt Unique Dual Indexing Add-on Kits. For details, please refer to the Lexogen 12 nt Unique Dual Indexing Add-on Kits Instruction Manual (107IM223).

Lane Mix Preparation

Libraries should ideally be pooled in an equimolar ratio for multiplexed sequencing. It is important to ensure accurate quantiﬁcation of the individual libraries prior to pooling, as well as for the library pool (lane mix). To quantify your libraries:

Measure the concentration of each library, using either qPCR or ﬂuorescence-based

assays (e.g., QuBit, Thermo Fisher Scientiﬁc Inc.).

Determine the average library size, using microcapillary electrophoresis analysis (e.g., Bioanalyzer, Agilent Technologies, Inc.). Set the range to 160 - 1,000 bp to include the

whole library size distribution, and to exclude any linker-linker artifacts (150 bp), or overcycling bumps (>1,000 bp).

Molarity is then calculated from the average library size and the concentration (ng/l) using the following equation:

Molarity = (library concentration (ng/l) x 106 ) / (660 x average library size (bp))

A template for molarity calculation is also available for download from www.lexogen.com.

36 LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 40

After pooling the libraries, the prepared lane mix and any dilutions made for denaturing (e.g., 2 nM), should be reanalyzed to ensure the accuracy of the concentration. This can be performed according to steps 1 and 2 as above.

Lane Mix Repuriﬁcation to Remove Linker-Linker Artifacts

A shorter side-product representing linker-linker artifacts is sometimes visible at ~150 bp, and should not compose more than 0 - 3 % of the total lane mix for sequencing. If the fraction of linker-linker, or other small fragments (≤150 bp) are too prominent, repuriﬁcation of the lane mix prior to sequencing is advised.

Libraries or lane mixes can be repuriﬁed using the Puriﬁcation Module with Magnetic Beads (Cat. No. 022) using the following protocol.

Measure the volume of the library or lane mix. If the volume is less than 20 µl, adjust the

total volume to 20 µl using Elution Buﬀer (EB) or molecular biology-grade water (H2O).

Add 0.9 volumes (0.9x) of Puriﬁcation Beads (PB). Mix thoroughly and incubate for 5

minutes at room temperature. EXAMPLE: For 50 µl of lane mix, add 45 µl PB.

Follow the detailed protocol from step 30 onwards (p.16-17).

37LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 41

18. Appendix L: Sequencing

General

The amount of library loaded onto the ﬂow cell will greatly inﬂuence the number of clusters generated. Machine-speciﬁc loading instructions can be found at www.lexogen.com under QuantSeq Frequently Asked Questions (FAQs 1.24 (FWD), and 1.26 (REV)).

We do not recommend multiplexing Lexogen libraries with libraries from other vendors in the same sequencing lane.

Due to size diﬀerences, libraries prepared with the Lexogen Small RNA-Seq Library Prep Kit (or any other small RNA library prep kit) should not be sequenced together with QuantSeq, or QuantSeq-Flex libraries. Please refer to the sequencing guidelines for each library type (library adapter details, loading amounts to use, and use of custom sequencing primers, etc), which are provided in our Library Prep Kit User Guides, and online Frequently Asked Questions (FAQs).

QuantSeq FWD Libraries with i7 Indexing (Cat. No. 015)

i7 indices (6 nt) are introduced during PCR (step 27). For QuantSeq FWD libraries, Read 1 directly corresponds to the mRNA sequence.

5’-(Read 1 Sequencing Primer)-3’

5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-(Insert…

3’TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA-(Insert…

5’-(Index 1 (i7) Sequencing Primer)-3’

…Insert)- AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-i7-ATCTCGTATGCCGTCTTCTGCTTG 3’

…Insert)- TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG-i7-TAGAGCATACGGCAGAAGACGAAC 5’

3’-(Read 2 Sequencing Primer)-5’

Read 1: Multiplexing Read 1 Sequencing Primer (not supplied): 5’ ACACTCTTTCCCTACACGACGCTCTTCCGATCT 3’

Index 1 Read (i7): Multiplexing Index 1 Sequencing Primer (not supplied): 5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCAC 3’

Read 2: Multiplexing Read 2 Sequencing Primer (not supplied): 5’ GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3’

Note: Some nucleotide sequences shown in Appendix L may be copyrighted by Illumina, Inc.

38 LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 42

ATTENTION: We do not recommend paired-end sequencing for QuantSeq FWD librarires (Cat.

No. 015), as the quality of Read 2 would be very low due to the poly(T ) stretch at the beginning of Read 2. In case QuantSeq FWD libraries are sequenced in paired-end mode, read 2 should be discarded and downstream data analysis should be performed using only read 1. Read 1 read quality is not adversely aﬀected in paired-end runs.

However, if paired-end sequencing for alignment of read pairs is required, please use QuantSeq REV (Cat. No. 016).

QuantSeq REV Libraries with i7 Indexing (Cat. No. 016)

i7 indices (6 nt) are introduced during PCR (step 27). For QuantSeq REV libraries, Read 1 corresponds to the cDNA sequence.

5’-(Read 1 Custom Sequencing Primer)-3’

5’AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT-TTTTTTTTTTTTTTTTTT-Insert…

3’TTACTATGCCGCTGGTGGCTCTAGATGTGAGAAAGGGATGTGCTGCGAGAAGGCTAGA-AAAAAAAAAAAAAAAAAA-Insert…

5’-(Index Read Sequencing Primer)-3’

…Insert- AGATCGGAAGAGCACACGTCTGAACTCCAGTCAC-i7-ATCTCGTATGCCGTCTTCTGCTTG 3’

…Insert- TCTAGCCTTCTCGTGTGCAGACTTGAGGTCAGTG-i7-TAGAGCATACGGCAGAAGACGAAC 5’

3’-(Read 2 Sequencing Primer)-5’

Read 1: Custom Sequencing Primer Version 5 (CSP , included): 5’ ACACTCTTTCCCTACACGACGCTCTTCCGATCTTTTTTTTTTTTTTTTTTT 3’

ATTENTION: Do not use Multiplex Read 1 Sequencing Primer for QuantSeq REV (Cat. No. 016.24,

Cat. No. 016.96, Cat. No. 016.2x96). Multiplex Read 1 Sequencing primer would result in a failed sequencing run as cluster calling would be impossible due to the poly(T ) stretch.

ATTENTION: Do not mix CSP and Read 1 Sequencing Primer! A primer mixture would result

in low clusters calls and the resulting reads would be contaminated by poly(T) stretches.

Index 1 Read (i7): Multiplexing Index 1 Sequencing Primer (not supplied): 5’ GATCGGAAGAGCACACGTCTGAACTCCAGTCAC 3’

Read 2: Multiplexing Read 2 Sequencing Primer (not supplied):

5’ GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT 3’

39LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 43

Usage of the Custom Sequencing Primer

For QuantSeq REV (Cat. No. 016) the Read 1 linker sequence is located at the 5’ end of the oligodT primer. Here a Custom Sequencing Primer Version 5 (CSP , included in the kit) is required for Read 1. The CSP covers the poly(T) stretch. Without the CSP cluster calling is not possible.

NOTE: QuantSeq REV kits were previously supplied a diﬀerent version CSP (Version 2) that is

not compatible with all Illumina instruments. Please check the CSP version number on the

tube provided before sequencing.

ATTENTION: Do not mix CSP and Read 1 Sequencing Primer! Do not mix CSP into HP10! A

primer mixture would result in low cluster calls and the resulting reads would be contaminated by poly(T ) stretches.

HiSeq 2000, HiSeq 2500 (CSP added on cBot)

The CSP should be provided in a tube strip at 0.5 µM ﬁnal concentration in a volume of 120 µl (ﬁnal concentration 0.5 µM, to be diluted in HT1 = Hybridization buﬀer). Take 0.6 µl of 100 µM CSP and add 119.4 µl of HT1 buﬀer per sequencing lane. Place the 8-tube strip into the cBot position labeled primers.

HiSeq 2500 (CSP replaces HP10 in cBot Cluster Generation Reagent Plate)

Alternatively, the CSP can be placed directly into the cBot Cluster Generation Reagent Plate.

ATTENTION: The standard Illumina Multiplex Read 1 Sequencing Primer solution HP10 (for V4

chemistry located in row 2) provided in the cBot Cluster Generation Reagent Plate has to be

REMOVED ﬁrst! The Illumina V4 chemistry cBot Cluster Generation Reagent Plate only has 8

rows ﬁlled. A simple trick is to have the empty rows facing towards you, this way if you want to use a CSP in lane 1, you have to remove the HP10 solution from well 1 (ﬁrst one on the far left) of the second row, rinse the well a couple of times with HT1 and then add the diluted CSP . For this take 1.25 µl of 100 µM CSP and add 248.75 µl of HT1 buﬀer per sequencing lane. The CSP should be at 0.5 µM ﬁnal concentration in a volume of 250 µl (ﬁnal concentration 0.5 µM, to be diluted in HT1 = Hybridization buﬀer). ATTENTION: Do not add the CSP to the Standard Illumina Multiplex Read 1 Sequencing Primer = HP10 solution! Always use fresh HT1 and add the CSP / HT1 dilution to the empty and rinsed well.

HiSeq 2500 - Rapid Run

Add 12.5 µl of 100 µM CSP to 2,487.5 µl HT1 = Hybridization buﬀer, resulting in a total volume of 2.5 ml and a ﬁnal CSP concentration of 0.5 µM. In a rapid run, both lanes will use the same sequencing primer. It is not possible to run the two lanes with diﬀerent sequencing primers.

40 LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 44

MiSeq

Clustering is performed on the machine, not on the cBot. The MiSeq uses a reservoir of 600 µl with

0.5 µM sequencing primer ﬁnal concentration, i.e., 3 µl of 100 µM CSP in 597 µl HT1.

HiSeq 3000, HiSeq 4000 (CSP replaces HP10 in cBot Cluster Generation Reagent Plate)

The direct addition of custom sequencing primers is currently not supported on HiSeq 3000 and 4000 machines. However, the CSP can be used when performing cluster generation with the cBot Cluster Generation Reagent Plate. See the instructions above for the HiSeq 2500 (CSP RE

PLACES HP10 in the cBot Cluster Generation Reagent Plate). ATTENTION: Do not add the CSP

to the HP10 solution! A primer mixture would result in low clusters calls and the resulting reads

would be contaminated by poly(T ) stretches. Always use fresh HT1 and add the CSP / HT1 dilution to the empty and rinsed well.

NextSeq

The CSP Version 5 is optimized for use on NextSeq 500 / 550 instruments for sequencing.

Spin down the provided tube of CSP before use. Add 6 µl of 100 µM CSP to 1,994 µl of HT1 buﬀer (ﬁnal volume 2,000 µl). Mix well and spin down. The prepared CSP / HT1 solution (CSP ﬁnal concentration, 0.3 µM) can be then loaded into Position 7 of the NextSeq Reagent Cartridge. Please refer to page 7 of the NextSeq System Custom Primers Guide (Illumina) for further loading instructions.

MiniSeq and NovaSeq

Please contact support@lexogen.com if you wish to run QuantSeq REV on other 2-channel instruments, including: MiniSeq, or NovaSeq.

ATTENTION: The CSP Version 2 included in QuantSeq REV kits produced prior to 2019 is not

compatible with NextSeq instruments! Please check the CSP version number on the tube

provided before sequencing.

NOTE: FORWARD THIS INFORMATION along with the CSP and the lane mix to YOUR SE-

QUENCING FACILITY before starting an NGS run.

41LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 45

19. Appendix M: Data Analysis

This section describes a basic bioinformatics workﬂow for the analysis of QuantSeq data and is kept as general as possible for integration with your standard pipeline. QuantSeq is available in two read orientations: QuantSeq FWD (Cat. No. 015) contains the Read 1 linker sequence in the 5’ part of the second strand synthesis primer, hence NGS reads are generated towards the poly(A) tail. To pinpoint the exact 3’ end, longer read lengths may be required. Read 1 directly reﬂects the mRNA sequence. In QuantSeq REV (Cat. No. 016), the Read 1 linker sequence is located at the 5’ end of the oligodT primer. For Read 1, a Custom Sequencing Primer (CSP , included in the kit) has to be used. With QuantSeq REV it is possible to exactly pinpoint the 3’ end during Read 1. The reads generated during Read 1 reﬂect the cDNA sequence, so they are in a strand orientation opposite to the genomic reference. For paired-end sequencing where alignment of read pairs is required, we recommend using QuantSeq REV (Cat. No. 016).

For more detailed information please refer to www.lexogen.com/quantseq-data-analysis and

www.lexogen.com/quantseq-data-analysis-rev, respectively.

Demultiplexing

Demultiplexing can be carried out by the standard Illumina pipeline. Lexogen i7 and i5 6 nt

index sequences are available for download at www.lexogen.com.

Processing Raw Reads

We recommend the use of a general fastq quality control tool such as FastQC or NGS QC Toolkit to examine the quality of the sequencing run. These tools can also identify over-represented sequences, which may optionally be removed from the dataset.

Trimming

The reads should be trimmed to remove adapter sequences, poly(A) / poly(T) sequences, and low quality nucleotides. Reads that are too short (i.e., <20 nt) or have generally low quality scores should be removed from the set. In addition, for QuantSeq FWD libraries, as second strand synthesis is based on random priming, there is a higher proportion of mismatches over the ﬁrst 12 nt of the reads. For QuantSeq FWD data we therefore recommend using an aligner that can perform soft-clipping of the read ends (e.g., STAR aligner) during alignment, or increasing the number of allowed mismatches to 14. Alternatively, trimming the ﬁrst 12 nt of Read 1 can be performed prior to alignment when using a more stringent aligner (e.g., HISAT2). While trimming the read can decrease the number of reads of suitable length for alignment, the absolute number of mapping reads may increase due to the improved read quality.

42 LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 46

For QuantSeq REV data, single-read sequencing does not require any trimming using QuantSeq REV (Cat. No. 016). However, paired-end sequencing may require the ﬁrst 12 nucleotides of Read 2 to be trimmed. Alternatively, also here the STAR aligner could be used with the number of allowed mismatches being set to 16 for paired-end reads.

Alignment

After ﬁltering and trimming, reads can be aligned with a short read aligner to the reference genome. We recommend the use of STAR aligner for mapping QuantSeq data (FWD and REV). The reads may not land in the last exon and span a junction hence splice-aware aligners should be used. Bowtie2, BBMap, or BWA can also be used for mapping against a reference transcriptome.

Annotations and Read Counting

Mapping only the 3’ end of transcripts requires an annotation that covers the 3’ untranslated region (UTR) accurately. Conservative annotations might decrease the power of correct gene quantiﬁcation after mapping, especially in case of QuantSeq REV (Cat. No. 016). For some gene annotations it might be an advantage to extend the 3’ UTR annotation further downstream in order to assign the mapped read correctly.

Integrated Data Analysis Pipeline at Bluebee®

Each purchased QuantSeq kit includes a code for free data analysis including diﬀerential expression (DE) analysis using the Bluebee® Genomics Platform (for fastq(.gz) ﬁle sizes up to 1.5 GB). The activation code can be found on a sticker on the side of the inner reagent box (stored at -20 °C). Each provided code allows for the same number of data analysis pipeline runs as the number of reactions included in the library prep kit (i.e., for a 24 prep kit, 24 analysis runs can be performed). Activation codes for additional pipeline runs can also be purchased from Lexogen (Cat. No.’s 090, 091, 093, and 094). The FWD or REV-speciﬁc pipelines are automatically encoded in the allocated activation code supplied with the respective QuantSeq Kit, ensuring that the correct pipeline parameters are used for the diﬀerent FWD and REV read orientations. Please visit www.bluebee.com/lexogen/ for more information and to access the data analysis pipelines. To login, enter the code received with the kit. For further inquiries, please contact info@

lexogen.com.

Details of the technical parameters used for QuantSeq data analysis pipelines on the Bluebee platform are provided in the QuantSeq 3’ mRNA-Seq Integrated Data Analysis Pipeline on Bluebee Platform User Guide, available online from www.bluebee.com/lexogen.

QuantSeq FWD-UMI Data Analysis

Sequencing data from QuantSeq FWD libraries prepared with the UMI Second Strand Synthesis Module (Cat. No. 081), can be analyzed using the FWD-UMI QuantSeq Data Analysis pipelines available on the Bluebee® Genomics Platform. Simply use the activation code included with your

43LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 47

QuantSeq FWD Library Prep Kit and select the respective “FWD-UMI” pipeline when setting up your data analysis run. For further information regarding the pipeline workﬂow please refer to the QuantSeq 3’ mRNA-Seq Integrated Data Analysis Pipeline on Bluebee Platform User Guide, available online from www.bluebee.com/lexogen.

An additional tool package (collapse_UMI_bam) is also available for command-line analysis and performs de-duplication of sequencing read counts for QuantSeq FWD-UMI data. To obtain a copy of the binary tool package for your speciﬁed operating system, or for further information on UMI data analysis methods, please contact support@lexogen.com.

44 LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 48

20. Appendix N: Automation

Automating the process of library preparation has the advantage of avoiding sample tracking errors, dramatically increasing throughput, and saving hands-on time. QuantSeq is ideally suited to automation, and QuantSeq automation protocols are available for a range of liquid handling instruments, including but not limited to:

• Perkin Elmer: Sciclone® / Zephyr®

• Hamilton: Microlab STAR / STARlet / NGS STAR

• Agilent: NGS Workstation (NGS Bravo Option B)

• Beckman Coulter: Biomek FXP, and Biomek i7

• Eppendorf: EpMotion® 5075

Instrument setups can vary widely, so if you are interested in QuantSeq automation scripts for these, or other liquid handling instruments not listed, please contact us at support@lexogen.

com or check our online FAQs for more information (https://www.lexogen.com/quantseq-3mr- na-sequencing/#quantseqautomation).

The standard QuantSeq 96 prep, 2x 96 prep and HT (384 prep) kits provide suﬃcient reagents for QuantSeq automation library preparation, hence there is no separate kit for QuantSeq automation Library Prep.

Dummy reagents that mimic the QuantSeq reagent properties, designed to assist with the setup of QuantSeq automation protocols are available upon request. Please email support@lexogen.com for more information.

45LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 49

21. Appendix O: Revision History

The revision history table below shows user guide versions and kit changes made from 2017 onwards. The full revision history is available from www.lexogen.com.

Publication No. / Revision Date

015UG009V0252

Apr. 3, 2020

015UG009V0251

Feb. 26, 2019

015UG009V0241

Aug. 27, 2018

015UG009V0240

Jun. 5, 2018

Change Page

Updated General terms and conditions. 2

Updated storage recommendations of EB buffer. 6

Added references to Lexogen UDI 12 nt Unique Dual Indexing.

Reformatted Step 29. 16

Updated recommendations for DNase I treatment. 20

Naming changes for: “i7 Index Plate” to “Lexogen i7 6 nt Index Set”, and “i5 Dual Indexing Add-on Kit” to “Lexogen i5 6 nt Dual Indexing Add-on Kit”.

New CSP Version (V5) included in REV kits - CSPV5 is supported for use on HiSeq, MiSeq, MiniSeq, and NextSeq instruments.

“REMARK” notes in steps 1 - 4 edited to refer only to specific instructions for low input/low quality/FFPE samples.

Instructions for use of RS-Globin Block and UMI modules in place of RS and SS1, respectively, were added to detailed protocol steps 5 and 7.

Reformatting of attention notes in detailed protocol. 11-17

Short protocol format updated to include clear steps for low quality / low input / FFPE protocol modifications, and to include qPCR assay steps.

Text and figures updated for Appendices A - N. 20-45

Revision history table includes 2017 onwards only. 46-47

Updated sequencing guidelines for Lexogen libraries. 39

Safe stopping point removed after step 4: Proceed immediately to RNA removal.

Updated text for RNA input and PCR cycles in Appendix B. 22-23

Updated text and added table of protocol modifications for low input in Appendix C.

Modiﬁed format and text for Appendix E: qPCR and F: Library Reampliﬁcation.

Added new Appendix I: Globin Block Modules. 32-33

Added new Appendix J: Unique Molecular Identiﬁers. 34-35

Added information on dual indexing, lane mix preparation, and repurification to Appendix K.

Reduced Revision history table to show updates from 201 onwards. 46-47

4, 15, 16,

36, 48

6-48

39-41

11-12

12-13

18-19

26-27

37-38

46 LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 50

015UG009V0230

Nov. 22, 2017

015UG009V0223

Sep. 5, 2017

015UG009V0222

Jul. 6, 2017

015UG009V0221

Mar. 8, 2017

015UG009V0220

Feb. 7, 2017

Added remark: Pre-warm mastermixes for ﬁrst strand synthesis (step 3). 11

Added sample handling guidelines for critical steps during ﬁrst strand synthesis, for low input / low quality samples.

11-12

Revised attention text for PCR cycle numbers. 14

Minor revision of text in appendices B, C, D, and E. 21-24

Link for https://www.bluebee.com/lexogen updated. 35, 38

Correction of ﬁgure labels for Appendices F and G. 26-28

After denaturing (step 2), leave the reactions on the thermocycler at 42 °C until step 4.

Dry the beads only at room temperature after ethanol washes. 13, 16

Short procedure reformatted over 2 pages, font size increased and Attention notes added for First Strand cDNA Synthesis steps.

17, 18

Page numbers for appendices were changed and SIRVs text updated. 19-34

Updated machine-speciﬁc instructions for sequencing. 30, 33

Do not cool the FS2/E1 mastermix! Safe stopping point. Typos ﬁxed.

RS1, renamed to RS. No more RS2 solution, hence one step less in the protocol.

A new SS1 solution (now only 10 µl have to be added not 15 µl as previously).

The total volume of the second strand synthesis reaction is now 40 µl (previously it was 50 µl).

Post second strand synthesis only 16 µl PB have to be added (previously it was 20 µl).

In step 16 (was previously step 17) only 56 µl PS have to be added (previously it was 72 µl).

Barcode Plate (BC) was rearranged for improved balance and renamed to i7 Index Plate (7001-7096). Previous BC05: TAATCG replaced by 7025: TTTATG to avoid overlap with Illumina-speciﬁc indices.

11, 15-

17, 22

12, 17

13, 17

4-6,

14-30

Barcode 00 (BC00) in PCR Add-on Kit renamed to P7 Primer 7000. 23

qPCR endpoint determination using only 1.7 µl template and set to 50 % FU (previously 33 %). Subtract 3 cycles from determined endpoint (EP)

when using 10x as much template (17 µl in EP, 1.7 µl in qPCR).

Evaluation tool to check the color balance of index subsets. 28

47LEXOGEN · QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Page 51

Associated Products:

015 (QuantSeq 3‘ mRNA-Seq Library Prep Kit for Illumina (FWD) HT including Lexogen i5 6 nt Dual Indexing Add-on Kit (5001-5004)) 020 (PCR Add-on Kit for Illumina) 022 (Puriﬁcation Module with Magnetic Beads) 025, 050, 051 (SIRVs Spike-in RNA Variant Control Mixes) 026 (QuantSeq-Flex First Strand Synthesis Module for Illumina) 028 (QuantSeq-Flex Second Strand Synthesis Module V2 for Illumina) 044 (Lexogen i7 6 nt Index Set (7001-7096)) 047 (Lexogen i5 6 nt Dual Indexing Add-on Kits (5001-5096)) 070 (RS-Globin Block, Homo sapiens) 071 (RS-Globin Block, Sus scrofa) 080 (Reampliﬁcation Add-on Kit for Illumina) 081 (UMI Second Strand Synthesis Module for QuantSeq FWD (Illumina, Read 1)) 107 - 111, 120 (Lexogen UDI 12 nt Unique Dual Indexing Add-on Kits) 113 - 115, 129 - 131 (QuantSeq 3‘ mRNA-Seq Library Prep Kit FWD with UDI 12 nt Sets)

QuantSeq 3‘ mRNA-Seq Library Prep Kit · User Guide

Lexogen GmbH

Campus Vienna Biocenter 5

1030 Vienna, Austria

Telephone: +43 (0) 1 345 1212-41

Fax: +43 (0) 1 345 1212-99

E-mail: support@lexogen.com

Lexogen QuantSeq User Manual

Specifications and Main Features

Frequently Asked Questions

User Manual

001UI182V0100