GeneCopoeia MAK-GCM-30 User Guide

Page 1
MethylAffinityTM Methylated DNA Enrichment Kit For rapid purification and enrichment of methylated DNA
Cat.No.MAK-GCM-30 (30 reactions)
User Manual
GeneCopoeia, Inc. 9620 Medical Center Drive, #101 Rockville, MD 20850 USA
301-762-0888 866-360-9531
inquiry@genecopoeia.com www.genecopoeia.com
© 2010 GeneCopoeia, Inc.
Page 2
MethylAffinityTM Methylated DNA Enrichment Kit User Manual
USER MANUAL
MethylAffinityTM Methylated DNA Enrichment Kit
I. Introduction II. Advantages and Protocol Overview III. Kit Components and Storage IV. DNA Preparation and Fragmentation V. Methylated DNA Enrichment Procedure VI. References VII. Limited Use License and Warranty
I. Introduction
DNA methylation in mammals is involved in many cellular processes and is responsible for gene silencing by recruitment of transcriptional repression complexes. It plays a critical role in development. However, massive methylation of the promoter regions has been frequently observed in cancer, which can cause transcription repression of tumor suppressor and DNA repair genes.
MethylAffinityTM Methylated DNA Enrichment Kit provides a GCM-bead-based method for quick enrichment of methylated DNA fragments from whole genome1. The enriched sample improves the performance of downstream analysis, such as RT-PCR, microarray and sequencing, for methylation status and location studies.
GCMrecombinant protein is designed based on the functional domain of methyl binding domain (MBD) proteins2. It binds specifically to double-stranded DNA (e.g.genomic DNA) containing methylated CpG dinucleotides, unlike methylated DNA antibodies which can only bind to single-stranded DNA.
Compared to wild-type MBD proteins, GCM has much stronger affinity for methylated DNA and minimal affinity for non-methylated DNA, which makes the binding more specific. The affinity for GCM is proportional to the density of methylated CpG dinucleotides contained in the DNA fragment.
II. Advantages and Protocol Overview Fewer steps and less time
In MethylAffinityTM Methylated DNA Enrichment Kit, GCMis provided as immobilized GCM magenta beads. GCM was cross-linked to GeneCopoeia's proprietary magenta beads through strong non-covalent binding. The immobilized GCM beads significantly simplify the protocol. Starting from fragmented DNA samples, the whole procedure can be completed in less than 2 hours (see Protocol Overview).
Highly Sensitive
The genetically engineered GCM has much higher affinity than the wild type MBD. The GCM beads are able to isolate DNA fragments which contain only a few of methylated CpG dinucleotides and can be used to enrich methylated DNA from nanograms of genomic DNA sample.
Easy to handle
The magenta color of the GCM™ beads makes the pellet very easy to spot, which greatly reduces the risk of incidental beads loss.
2
Page 3
MethylAffinityTM Methylated DNA Enrichment Kit User Manual
Contents
Amounts (30 rxns)
Shipping temperature
Storage temperature
GCMTM beads (25% suspension)
600 µl
Ice pack
-20°C Stable for at least 12 months
Binding Buffer (contains 300 mM NaCl)
35 ml
Ice pack
4°C Stable for at least 12 months
Elution Buffer (contains 1 M NaCl)
5 ml
Ice pack
4°C Stable for at least 12 months
Low salt Buffer (contains no NaCl)
10 ml
Ice pack
4°C Stable for at least 12 months
High salt Buffer (contains 2 M NaCl)
10 ml
Ice pack
4°C Stable for at least 12 months
pUC19 DNA (0.5 µg/µl, sonicated)
150 µl
Ice pack
-20°C Stable for at least 12 months
Mouse genomic DNA3, sonicated (100 ng/µl)
15 µl*
Ice pack
-20°C Stable for at least 12 months
Beta actin promoter primer set for negative control3 (2 µM)
30 µl*
Ice pack
-20°C Stable for at least 12 months
GAPDH promoter primer set for negative control3 (2 µM)
30 µl*
Ice pack
-20°C Stable for at least 12 months
IAP primer set for positive control3 (2 µM)
30 µl*
Ice pack
-20°C Stable for at least 12 months
Consistency
All kit components are produced using highest-quality reagents. The kits are strictly quality controlled to ensure batch-to-batch consistency.
Protocol Overview
Rinse and pellet GCMTM beads
Bind methylated genomic DNA fragments to the GCMTM beads
1 hour at RT
Pellet the beads. Wash to remove non-methylated DNA
Elute methylated DNA from the beads
------------------------------------­Total < 2 hours
III. Kit Components and Storage
Sufficient kit components are provided for enriching methylated DNA from up to 30 µg of fragmented genomic DNA.
Note: GCM beads are supplied as 25% (v/v) suspension in a buffer containing 50% (v/v) glycerol. Remove only the amount of beads required shortly before use. *Sufficient mouse genomic DNA and control primer sets are provided for 15 control reactions.
3
Page 4
MethylAffinityTM Methylated DNA Enrichment Kit User Manual
Materials required but not supplied
Rotisserie Shaker Low-absorption 1.5 ml tubes (recommended product: Eppendorf's DNA LoBind 1.5ml Tubes, order # 022431021) DNase-free ultrapure water
3.0 M sodium acetate, pH 5.2 100% ethanol 75% ethanol TE buffer: 10 mM Tris-Cl (pH 7.5), 1 mM EDTA Reagents for PCR assays
IV. DNA preparation and fragmentation
1. Isolate genomic DNA using an established protocol. Determine the DNA concentration by UV
absorbance at 260nm. Check the DNA quality by agarose gel electrophoresis and ratio of OD260nm/OD280nm.
2. Fragment the genomic DNA using either sonication or restriction enzyme digestion. If the latter method is used, restriction enzyme Mse I (recognition site: 5'TTAA3') or Tsp509I (recognition site: 5'AATT3') is recommended. In either case, make sure that the genomic DNA is fragmented to 250-500 bp.
V. Methylated DNA enrichment procedure
The following protocol is for enriching methylated DNA from up to 1 µg of fragmented genomic DNA samples. For DNA samples greater than 1 µg, scale up proportionally.
Basic protocol (one-step elution)
1. Rinse and pellet the GCM™ beads
1) Gently tap the GCM™ beads tube to resuspend the beads evenly.
2) Transfer 20 µl of beads suspension to a 1.5 ml DNase free tube.
3) Add 200 µl of Binding Buffer to the beads. Mix gently.
4) Spin the tube briefly to pellet the beads. Carefully aspirate and discard the supernatant.
2. Bind methylated DNA to the GCM™ beads Sample tube:
1) Add fragmented genomic DNA (up to 1 µg) to the 1.5ml tube containing the GCM™ beads.
2) Then add 5 µl (2.5 µg) of pUC19 DNA to the tube.
3) Bring the final volume to 100 µl with Binding Buffer. Control tube:
1) Add 1 µl mouse genomic DNA3 (100 ng) provided in the kit to the 1.5ml tube containing the
GCM™ beads.
2) Then add 5 µl (2.5 µg) of pUC19 DNA to the tube.
3) Bring the final volume to 100 µl with Binding Buffer. Close the tubes tightly and rotate the tubes on a rotisserie shaker for 1 hour at room
temperature. Alternatively, the tubes can be rotated overnight at 4oC.
3. Wash the beads
1) Spin the tubes at 1,000×g for 1 minute to pellet the beads.
4
Page 5
MethylAffinityTM Methylated DNA Enrichment Kit User Manual
2) Carefully transfer the supernatants to new tubes (Note: Save the supernatants here to make
sure the binding reaction was performed correctly and the methylated DNA has been captured).
3) Wash the beads with 200 µl Binding Buffer for 4 times. Carefully aspirate and discard the
supernatant completely.
4. One-step elution
1) Resuspend the beads with 25 µl Elution Buffer. Mix gently but thoroughly.
2) Incubate for 5 minutes at room temperature.
3) Spin the tubes at 1,000×g for 1 minute to pellet the beads.
4) Transfer the supernatants that contain eluted methylated DNA to new tubes.
5) Repeat the above elution process and pool the supernatants from this step and the previous
step.
Note: For gradient elution, please see below.
Gradient elution protocol (Optional)
To study methylation status precisely, sometimes fractionation of methylated DNA fragments based on the density of methylated CpG dinucleotides is required. In such cases, gradient elution can be performed.
In the MethylAffinityTM Methylated DNA Enrichment Kit, besides the standard Elution Buffer, which contains 1 M NaCl, a Low Salt Buffer (containing no NaCl) and a High Salt Buffer (containing 2 M NaCl) are also provided. Gradient concentrations of NaCl (from 350 mM to 2 M) can be easily prepared by mixing the Low Salt and High Salt Buffers at different ratios.
Instead of performing standard elution at Step 4, elution buffers with gradient salt concentration from low to high can be used to elute and fractionate methylated DNA fragments based on the density of methylated CpGs.
Note: The enriched methylated DNA can be used directly for quantitative PCR analysis or stored at ­20°C for later use. The DNA can also be precipitated by adding 3 M sodium acetate (at 1/10th sample volume) and cold 100% ethanol (at 3-fold of sample volumes).
VI. Appendix
Positive and negative control PCR reaction conditions and primer sequences
0.5 μl Template (enriched mouse genomic DNA)
0.25 μl Hot Start Taq polymerase (5U/μl) 5 μl 5x PCR reaction buffer 2 μl Forward primer set 2μM 1 μl 25 mM dNTP mix Add H2O to bring the final volume to 25 μl
PCR cycling conditions 95°C 10 min. x 1 95°C 10 sec., 60°C 10 sec., 72°C 15 sec. x 35 cycles 72C 7 min. x 1
The sequences of Beta actin promoter primers (negative control):
F: 5'AGCCAACTTTACGCCTAGCGT3' R: 5'TCTCAAGATGGACCTAATACGGC3'
5
3
Page 6
MethylAffinityTM Methylated DNA Enrichment Kit User Manual
The sequence of GAPDH promoter primers (negative control):
F: 5'CTCTGCTCCTCCCTGTTCC3' R: 5'TCCCTAGACCCGTACAGTGC3'
The sequence of IAP primers (positive control):
F: 5'CTCCATGTGCTCTGCCTTCC3' R: 5'CCCCGTCCCTTTTTTAGGAGA3'
VII. References
1. Cross, S.H., Charlton, J.A., Nan, X., and Bird, A.P. (1994). Purification of CpG islands using a methylated DNA binding column. Nature genetics 6, 236-244.
2. Fatemi, M., and Wade, P.A. (2006). MBD family proteins: reading the epigenetic code. Journal of cell science 119, 3033-3037.
3. Mohn, F., Weber, M., Schubeler, D., and Roloff, T.C. (2009). Methylated DNA Immunoprecipitation (MeDIP). Methods in molecular biology 507, 55-64
VI. Limited Use License and Warranty Limited Use License
Following terms and conditions apply to use of the MethylAffinityTM Methylated DNA Enrichment Kit (the Product). If the terms and conditions are not acceptable, the Product in its entirety must be returned to GeneCopoeia within 5 calendar days. A limited End-User license is granted to the purchaser of the Product. The Product shall be used by the purchaser for internal research purposes only. The Product is expressly not designed, intended, or warranted for use in humans or for therapeutic or diagnostic use. The Product must not be resold, repackaged or modified for resale, or used to manufacture commercial products or deliver information obtained in service without prior written consent from GeneCopoeia. This Product should be used in accordance with the NIH guidelines developed for recombinant DNA and genetic research. Use of any part of the Product constitutes acceptance of the above terms.
Limited Warranty GeneCopoeia warrants that the Product meets the specifications described in the accompanying Product Datasheet. If it is proven to the satisfaction of GeneCopoeia that the Product fails to meet these specifications, GeneCopoeia will replace the Product. In the event a replacement cannot be provided, GeneCopoeia will provide the purchaser with a refund. This limited warranty shall not extend to anyone other than the original purchaser of the Product. Notice of nonconforming
products must be made to GeneCopoeia within 30 days of receipt of the Product. GeneCopoeia’s
liability is expressly limited to replacement of Product or a refund limited to the actual purchase price. GeneCopoeia’s liability does not extend to any damages arising from use or improper use of the Product, or losses associated with the use of additional materials or reagents. This limited warranty is the sole and exclusive warranty. GeneCopoeia does not provide any other warranties of any kind, expressed or implied, including the merchantability or fitness of the Product for a particular purpose.
GeneCopoeia is committed to providing our customers with high-quality products. If you should have any questions or concerns about any GeneCopoeia products, please contact us at 301-762-
0888.
© 2010, GeneCopoeia, Inc.
GeneCopoeia Products are for Research Use Only Copyright © 2010 GeneCopoeia, Inc. Trademarks: GeneCopoeia™, MethylAffinity™, GCM™ (GeneCopoeia Inc.) MAKGCM-121010
6
Loading...